Entry information : HC14APx-CcP03
Entry ID 11759
Creation 2013-04-17 (Christophe Dunand)
Last sequence changes 2013-04-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-25 (Catherine Mathe (Scipio))
Peroxidase information: HC14APx-CcP03
Name HC14APx-CcP03
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. C14A    [TaxId: 755336 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HC14APx-CcP03
start..stop
S start..stop
HCO27APx-CcP02 875 0 1..550 1..550
HEC38APx-CcP02 858 0 1..550 1..551
TatAPx-CcP02 467 2e-160 22..547 20..546
ElaAPx-CcP1 455 8e-156 25..515 20..506
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14958..15620 663 N° 2 15676..15734 59 N° 3 15793..16087 295 N° 4 16143..16505 363
N° 5 16559..16831 273  
join(14958..15620,15676..15734,15793..16087,16143..16505,16559..16831)


exon

Literature and cross-references HC14APx-CcP03
DNA ref. JGI genome:   scaffold_80 (14958..16831)
Cluster/Prediction ref. JGI gene:   324446
Protein sequence: HC14APx-CcP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   551 (526)
PWM (Da):   %s   59834.93 (57217.6)  
PI (pH):   %s   4.3 (4.24) Peptide Signal:   %s   cut: 25 range:25-550
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARASSSWAVLLLAFVINTNRAAATYTWPNPDIDLLESIFYQHNGFRQFGLAFGVSPCNNMANTLETGRDDSAEWFRTAYHDMATADVESGIGGIDASIGFETERTENKGKAFNESVGFFLAFQSSRSSMADVIALAAALTVGSCSNGEVIVPFRGGRQDALEAGPTGVPQPEEDLDSHTAAFARQGFNVSEMIGLVACGHTIGGVHGENFPEIVDVVDDMDNQASRQNFDESFDNFDNSVATQFVANTSQNPLAFGRNETTRSDFRIFNADGGDLIRRMAESQRFFWDTCATLLERMLNTVPKGVQLTDVIEPIAVKPNNLFITVNSNGTQTVSGEVIMEDGATSTNREVLIHLRGRDNEDVPSSPIAAQTGEGYECLSYYNNMPNFTTYHFTTTVSTAVGVSSFDVQIKDENSDVTNTNGGQGFPWQDALLVQPAESCTSRESIDTRSNNTVKAVAAVRDDMEFELVQLVVPKPVNMIGTYAVRFEEAAVDMKKVKTLGNSGYSLYEASFSFLVIAVGPMKTFDLVAKGPKGTIENNFTRWADVGSC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCGCGCTTCTAGTTCATGGGCAGTGCTTTTGCTAGCCTTCGTCATAAACACAAACAGGGCAGCAGCCACATACACATGGCCCAATCCAGATATCGACTTGCTGGAAAGCATCTTC
TATCAGCACAATGGCTTTCGTCAGTTTGGTTTAGCTTTCGGTGTATCGCCTTGTAACAATATGGCAAACACGCTGGAGACAGGTCGTGATGACTCGGCGGAATGGTTCCGCACGGCGTAC
CACGACATGGCGACAGCAGACGTAGAATCAGGCATTGGGGGAATCGACGCATCGATCGGGTTCGAAACAGAGCGAACAGAGAATAAAGGTAAGGCGTTCAACGAGTCGGTTGGCTTTTTT
CTCGCCTTTCAGAGTTCAAGATCTTCTATGGCCGACGTAATCGCGCTCGCAGCAGCGTTGACGGTTGGCTCATGTTCAAACGGGGAAGTGATTGTTCCCTTTCGCGGCGGAAGGCAAGAT
GCCCTTGAGGCCGGTCCCACAGGAGTTCCCCAGCCAGAGGAAGATCTAGATTCGCATACGGCTGCCTTCGCAAGACAAGGGTTCAATGTGAGCGAGATGATCGGGCTAGTAGCTTGCGGC
CATACGATTGGTGGCGTGCATGGAGAAAACTTCCCCGAAATCGTTGACGTTGTCGATGATATG
GTAAGCTCTTGAGCATTGGGGTTACTTTGGGAACCAATCTGACATTTCCCTCGAGGA
TAATCAAGCGAGCCGTCAGAATTTCGATGAGTCGTTTGATAACTTTGATAATAGTGT
GTAAGTAGCCCTTGCACCCCTATACTCTTTGGCAGTCAGAGCTTACAGGGGTAACTAGTGCTA
CGCAATTCGTGGCCAACACCTCTCAAAATCCTCTAGCATTTGGACGCAACGAAACTACCAGGTCTGACTTTCGCATATTCAACGCTGATGGTGGAGATCTAATACGGCGAATGGCCGAGT
CTCAAAGATTTTTCTGGGATACATGCGCGACACTACTGGAACGTATGCTCAATACCGTGCCAAAGGGTGTTCAGTTAACGGACGTCATCGAACCTATTGCAGTGAAACCTAACAATCTTT
TTATTACGGTCAATTCTAACGGGACTCAAACAGTCTCCGGCGAAGTTCGG
GTAAGGGTTTATGAACCGTGTTCGTACTGATTGGCAATAGCTGACGGCAATATAGATAATGGAAGATGGC
GCAACATCAACTAACCGCGAAGTACTCATACATCTGAGGGGTCGGGATAATGAAGATGTCCCTTCTAGCCCTATTGCGGCACAGACAGGAGAAGGCTATGAATGTTTGTCTTATTACAAC
AACATGCCGAACTTTACCACCTATCATTTCACCACAACTGTTTCAACTGCCGTTGGTGTGTCATCCTTTGACGTCCAAATCAAAGATGAGAATTCCGACGTAACGAATACGAACGGAGGC
CAAGGCTTCCCTTGGCAAGATGCTCTCCTTGTGCAGCCGGCAGAGTCATGCACCTCTCGTGAATCCATTGACACCAGATCAAACAACACTGTGAAGGCGGTCGCAGCC
GTAAGTCTACTT
CAGCTCCTAACGTGAGATCTTCATGCCTGACACCTAGAAAGGTCCGTGACGATATGGAATTCGAATTGGTACAACTAGTAGTGCCAAAGCCTGTAAATATGATAGGCACATATGCAGTAC
GCTTCGAAGAGGCCGCCGTGGATATGAAGAAAGTGAAAACTCTGGGTAACTCTGGGTACTCACTATATGAGGCATCGTTCTCATTCCTTGTTATTGCGGTTGGTCCGATGAAGACATTCG
ATTTGGTGGCCAAGGGTCCGAAAGGAACCATTGAGAATAACTTCACAAGATGGGCCGATGTCGGTTCTTGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCGCGCTTCTAGTTCATGGGCAGTGCTTTTGCTAGCCTTCGTCATAAACACAAACAGGGCAGCAGCCACATACACATGGCCCAATCCAGATATCGACTTGCTGGAAAGCATCTTC
TATCAGCACAATGGCTTTCGTCAGTTTGGTTTAGCTTTCGGTGTATCGCCTTGTAACAATATGGCAAACACGCTGGAGACAGGTCGTGATGACTCGGCGGAATGGTTCCGCACGGCGTAC
CACGACATGGCGACAGCAGACGTAGAATCAGGCATTGGGGGAATCGACGCATCGATCGGGTTCGAAACAGAGCGAACAGAGAATAAAGGTAAGGCGTTCAACGAGTCGGTTGGCTTTTTT
CTCGCCTTTCAGAGTTCAAGATCTTCTATGGCCGACGTAATCGCGCTCGCAGCAGCGTTGACGGTTGGCTCATGTTCAAACGGGGAAGTGATTGTTCCCTTTCGCGGCGGAAGGCAAGAT
GCCCTTGAGGCCGGTCCCACAGGAGTTCCCCAGCCAGAGGAAGATCTAGATTCGCATACGGCTGCCTTCGCAAGACAAGGGTTCAATGTGAGCGAGATGATCGGGCTAGTAGCTTGCGGC
CATACGATTGGTGGCGTGCATGGAGAAAACTTCCCCGAAATCGTTGACGTTGTCGATGATATG
GATAATCAAGCGAGCCGTCAGAATTTCGATGAGTCGTTTGATAACTTTGATAATAGT
GT
TGCTACGCAATTCGTGGCCAACACCTCTCAAAATCCTCTAGCATTTGGACGCAACGAAACTACCAGGTCTGACTTTCGCATATTCAACGCTGATGGTGGAGATCTAATACGGCGAATG
GCCGAGTCTCAAAGATTTTTCTGGGATACATGCGCGACACTACTGGAACGTATGCTCAATACCGTGCCAAAGGGTGTTCAGTTAACGGACGTCATCGAACCTATTGCAGTGAAACCTAAC
AATCTTTTTATTACGGTCAATTCTAACGGGACTCAAACAGTCTCCGGCGAAGTTCGG
ATAATGGAAGATGGCGCAACATCAACTAACCGCGAAGTACTCATACATCTGAGGGGTCGGGAT
AATGAAGATGTCCCTTCTAGCCCTATTGCGGCACAGACAGGAGAAGGCTATGAATGTTTGTCTTATTACAACAACATGCCGAACTTTACCACCTATCATTTCACCACAACTGTTTCAACT
GCCGTTGGTGTGTCATCCTTTGACGTCCAAATCAAAGATGAGAATTCCGACGTAACGAATACGAACGGAGGCCAAGGCTTCCCTTGGCAAGATGCTCTCCTTGTGCAGCCGGCAGAGTCA
TGCACCTCTCGTGAATCCATTGACACCAGATCAAACAACACTGTGAAGGCGGTCGCAGCC
GTCCGTGACGATATGGAATTCGAATTGGTACAACTAGTAGTGCCAAAGCCTGTAAATATG
ATAGGCACATATGCAGTACGCTTCGAAGAGGCCGCCGTGGATATGAAGAAAGTGAAAACTCTGGGTAACTCTGGGTACTCACTATATGAGGCATCGTTCTCATTCCTTGTTATTGCGGTT
GGTCCGATGAAGACATTCGATTTGGTGGCCAAGGGTCCGAAAGGAACCATTGAGAATAACTTCACAAGATGGGCCGATGTCGGTTCTTGTTAA

Retrieve as FASTA