Entry information : MEspCIIAA01_NRRL54901
Entry ID 11761
Creation 2013-04-17 (Christophe Dunand)
Last sequence changes 2013-04-17 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-08-27 (Catherine Mathe)
Peroxidase information: MEspCIIAA01_NRRL54901
Name MEspCIIAA01_NRRL54901
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Melanconium sp. NRRL 54901    [TaxId: 1155951 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MEspCIIAA01_NRRL54901
start..stop
S start..stop
HC14CIIAA01 343 1e-117 30..350 31..352
XhypCIIAA02 310 1e-104 2..350 3..350
RrufCIIAA03 310 8e-104 19..350 22..357
HCO27CIIAA01 302 1e-101 30..350 31..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 658247..658769 523 N° 2 657697..658142 446 N° 3 657548..657631 84  
complement(join(657548..657631,657697..658142,658247..658769))


exon

Literature and cross-references MEspCIIAA01_NRRL54901
DNA ref. JGI genome:   scaffold_8 (658769..657548)
Cluster/Prediction ref. JGI gene:   19863
Protein sequence: MEspCIIAA01_NRRL54901
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351 (334)
PWM (Da):   %s   37163.09 (35484.1)  
PI (pH):   %s   4.22 (4.18) Peptide Signal:   %s   cut: 17 range:17-350
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSLLPVILAASVASASPYHANRDLFADLRNTPVLATRSTALLGDLLTEASSTLSAVGAEISSILTGILGAIADDDNYSPPGDIDSPECAKDTCCKWSHIVSDIRGSFSDGDGCTESARGAIRLGFHDAAAWNSSLPSGGADGSMVLNKDELGRPENLGLQEIAAQTQSWFDKYKQYNITMADLIQMDAIAATAACPGGPRIKAYVGRVDSDELPPEGLIPSPFADAQTNIALFEAKTFTAADLVALIGAHTVSQQRFVDPSQAGKSQDTTDSVWDNKYYGETASPTTPEGVFKFQSDISLANDSETSGTWQNFARNQGAWEAAYAPAYFRMSLLGVNNLNELTDCSHVV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCTCTCTCCTACCTGTCATCCTGGCTGCCTCGGTGGCCAGTGCTAGTCCCTATCATGCCAACAGAGACCTCTTCGCAGATCTCCGCAACACACCTGTTCTCGCAACTCGGTCAACA
GCCCTCCTGGGAGACCTCCTGACCGAGGCATCAAGCACCCTCTCCGCAGTGGGCGCTGAGATCTCCTCCATCCTCACTGGTATCTTGGGCGCTATCGCAGATGATGATAATTACTCGCCG
CCGGGTGACATCGACTCGCCCGAGTGTGCAAAGGACACCTGCTGCAAGTGGAGCCATATTGTTTCTGACATCCGGGGGAGCTTCTCGGACGGCGACGGGTGCACCGAGTCCGCCCGCGGC
GCGATCCGGCTTGGCTTTCACGACGCCGCTGCCTGGAATTCATCGCTGCCGAGCGGCGGCGCCGACGGGAGCATGGTGCTAAACAAGGATGAGCTGGGCCGTCCCGAGAACCTCGGCCTG
CAGGAGATCGCGGCGCAGACACAGTCTTGGTTCGACAAGTACA
GTGCGTTCCATTCTCTCCCTCCATTGTCCTCCAACTGTCATGTTTTGAAATATCCCAGCTCGTATCACTTCGGGACT
CCATAGCAAGGGGCTAATGTGTAACAGAGCAATACAACATTACCATGGCCGATCTCATCCAGATGGACGCCATCGCCGCGACGGCAGCGTGCCCCGGCGGCCCGCGCATCAAGGCCTACG
TCGGGCGCGTGGACAGCGACGAGCTCCCGCCCGAGGGGCTCATCCCCAGCCCGTTTGCTGATGCGCAGACCAACATCGCGCTGTTCGAGGCAAAGACCTTCACGGCAGCTGACCTGGTCG
CTCTCATCGGTGCGCACACAGTCAGCCAGCAACGCTTTGTCGACCCTTCGCAGGCGGGTAAGAGCCAGGACACGACGGATAGCGTGTGGGACAACAAATACTACGGCGAGACTGCGAGCC
CTACAACCCCTGAGGGGGTGTTCAAGTTCCAGAGCGATATCAGCCTGGCCAATGATTCTGAGACCTCTGGGACGTGGCAGAACTTTGCGAGGAACCAAGGGGCTTGGGAGGCT
GTAAGTT
GCCTTTTCCTATTTGCCTGACATTTCCGAATCCGGGTTGCTGACTTGGGGTTCCACAGGCATATGCACCTGCATATTTCAGGATGAGTCTGCTAGGTGTCAACAACCTGAATGAGTTGAC
GGACTGCTCTCACGTAGTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCTCTCTCCTACCTGTCATCCTGGCTGCCTCGGTGGCCAGTGCTAGTCCCTATCATGCCAACAGAGACCTCTTCGCAGATCTCCGCAACACACCTGTTCTCGCAACTCGGTCAACA
GCCCTCCTGGGAGACCTCCTGACCGAGGCATCAAGCACCCTCTCCGCAGTGGGCGCTGAGATCTCCTCCATCCTCACTGGTATCTTGGGCGCTATCGCAGATGATGATAATTACTCGCCG
CCGGGTGACATCGACTCGCCCGAGTGTGCAAAGGACACCTGCTGCAAGTGGAGCCATATTGTTTCTGACATCCGGGGGAGCTTCTCGGACGGCGACGGGTGCACCGAGTCCGCCCGCGGC
GCGATCCGGCTTGGCTTTCACGACGCCGCTGCCTGGAATTCATCGCTGCCGAGCGGCGGCGCCGACGGGAGCATGGTGCTAAACAAGGATGAGCTGGGCCGTCCCGAGAACCTCGGCCTG
CAGGAGATCGCGGCGCAGACACAGTCTTGGTTCGACAAGTACA
AGCAATACAACATTACCATGGCCGATCTCATCCAGATGGACGCCATCGCCGCGACGGCAGCGTGCCCCGGCGGCCCG
CGCATCAAGGCCTACGTCGGGCGCGTGGACAGCGACGAGCTCCCGCCCGAGGGGCTCATCCCCAGCCCGTTTGCTGATGCGCAGACCAACATCGCGCTGTTCGAGGCAAAGACCTTCACG
GCAGCTGACCTGGTCGCTCTCATCGGTGCGCACACAGTCAGCCAGCAACGCTTTGTCGACCCTTCGCAGGCGGGTAAGAGCCAGGACACGACGGATAGCGTGTGGGACAACAAATACTAC
GGCGAGACTGCGAGCCCTACAACCCCTGAGGGGGTGTTCAAGTTCCAGAGCGATATCAGCCTGGCCAATGATTCTGAGACCTCTGGGACGTGGCAGAACTTTGCGAGGAACCAAGGGGCT
TGGGAGGCT
GCATATGCACCTGCATATTTCAGGATGAGTCTGCTAGGTGTCAACAACCTGAATGAGTTGACGGACTGCTCTCACGTAGTGTAG

Retrieve as FASTA