Entry information : MEspCIIAA02_NRRL54901
Entry ID 11763
Creation 2013-04-19 (Christophe Dunand)
Last sequence changes 2013-04-19 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-08-27 (Catherine Mathe)
Peroxidase information: MEspCIIAA02_NRRL54901
Name MEspCIIAA02_NRRL54901
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Melanconium sp. NRRL 54901    [TaxId: 1155951 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MEspCIIAA02_NRRL54901
start..stop
S start..stop
CfioCIIAA02_PJ7 497 3e-176 1..387 1..394
CfioCIIAA02_MH18 497 3e-176 1..387 1..394
CgraCIIAA02 493 1e-174 19..390 17..396
GgrCIIAA02 480 2e-169 20..387 18..403
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1492218..1493207 990 N° 2 1491971..1492147 177 N° 3 1491811..1491915 105  
complement(join(1491811..1491915,1491971..1492147,1492218..1493207))


exon

Literature and cross-references MEspCIIAA02_NRRL54901
DNA ref. JGI genome:   scaffold_8 (1493207..1491811)
Cluster/Prediction ref. JGI gene:   32244
Protein sequence: MEspCIIAA02_NRRL54901
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   424 (404)
PWM (Da):   %s   46338.11 (44267.2)  
PI (pH):   %s   5.14 (5.01) Peptide Signal:   %s   cut: 20 range:20-423
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKFSTLVSSCACAASLVDAYPGMNKVLSEIQARQDNDTQFDSKELIGDLLNLTDSQLTPVGRSVKKIITDDGEDGQSNEGYPNVPPRDTPQCAADTCCIWHYISADMASKFRGPSGRCTDLARQAVRIGFHDAAGWSKATGPLGGADGSIVLAPEEMTRSANRGLEDIVDQMQDWFDEYSPYGASMADLIQMASTTATVVCPLGPRVRSFVGRKDSSVPAPDGLLPSPFDNADKLISLFQNKTIEPHGLTALLGAHTTSQQRFVDPARAGDPQDSTPGVWDVLYYKQTLDPNAPKRVFKFPSDISLSQDPRIAQEFQEFAGPGGQQHWNEDYAREYVRLSLLGVFNINNLTECTKVLPQPSAPFFNPPDQPVLNVWMNITRQIEPFAKAVCSRLLPKEVLANKVGIRLLPKEVGSHARVPVRW*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATTCAGCACTCTTGTCAGCTCGTGTGCCTGCGCGGCGTCGCTGGTTGACGCGTATCCAGGCATGAACAAGGTCCTATCTGAGATACAGGCCCGGCAAGACAATGATACACAATTT
GACTCGAAAGAGCTCATCGGAGACCTTCTCAACCTTACTGACTCTCAGCTGACACCCGTTGGGCGCTCAGTCAAGAAGATCATCACGGATGACGGCGAGGATGGCCAGTCCAACGAGGGA
TATCCGAACGTCCCACCTCGTGATACTCCCCAATGTGCCGCAGACACCTGTTGCATCTGGCACTACATTTCCGCCGACATGGCCTCCAAGTTCCGGGGCCCGTCAGGGAGGTGCACGGAC
CTGGCGCGGCAAGCGGTGCGAATAGGCTTCCATGACGCGGCAGGATGGTCCAAGGCAACCGGGCCGCTCGGCGGTGCTGACGGGAGCATTGTCCTCGCGCCTGAGGAGATGACTCGGTCG
GCGAACCGCGGACTGGAGGACATCGTCGACCAGATGCAGGACTGGTTCGACGAGTACAGCCCGTACGGGGCCAGCATGGCCGATCTCATACAGATGGCGAGCACCACGGCCACAGTCGTG
TGTCCCCTTGGCCCTCGTGTCAGATCCTTCGTTGGCAGGAAAGACAGCTCCGTCCCGGCACCAGACGGCTTGCTCCCCAGCCCATTCGATAACGCTGACAAGCTCATCTCACTCTTCCAA
AACAAGACCATCGAGCCGCATGGGCTCACTGCTCTCTTGGGTGCTCACACCACGTCACAGCAACGGTTTGTGGACCCTGCGAGAGCAGGAGACCCCCAGGACAGCACCCCTGGTGTCTGG
GACGTTCTGTACTACAAGCAAACTCTCGACCCCAACGCCCCAAAGCGTGTGTTCAAGTTCCCCAGTGACATAAGCCTATCGCAAGACCCGAGGATCGCGCAGGAATTTCAGGAATTTGCA
GGACCTGGCGGACAGCAGCACTGGAACGAG
GTATGCGATCCCACTCACCCAGATATATGAGATGTCCCAGAAGGAACTTCAGACTGATATCAAGTCGCAGGACTACGCCCGGGAGTACGT
GCGATTGAGCCTGCTGGGGGTCTTCAACATCAACAACCTGACGGAGTGCACAAAGGTCCTACCGCAGCCCAGTGCGCCATTCTTCAACCCTCCCGATCAGCCTGTCCTGAACGTGTGGAT
GAATATCACCCGCCAAATTGAGCCATTCGCAAAGGCT
GTTAGGGACGGGGAAATCCTCTCGGGCCTGATGGGCTTGCTGACTGGCCAGCAAGGTGTGCAGTCGACTGCTTCCCAAGGAGG
TTCTGGCCAACAAGGTGGGCATTCGACTGCTGCCCAAGGAGGTCGGAAGTCATGCAAGAGTTCCCGTAAGATGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATTCAGCACTCTTGTCAGCTCGTGTGCCTGCGCGGCGTCGCTGGTTGACGCGTATCCAGGCATGAACAAGGTCCTATCTGAGATACAGGCCCGGCAAGACAATGATACACAATTT
GACTCGAAAGAGCTCATCGGAGACCTTCTCAACCTTACTGACTCTCAGCTGACACCCGTTGGGCGCTCAGTCAAGAAGATCATCACGGATGACGGCGAGGATGGCCAGTCCAACGAGGGA
TATCCGAACGTCCCACCTCGTGATACTCCCCAATGTGCCGCAGACACCTGTTGCATCTGGCACTACATTTCCGCCGACATGGCCTCCAAGTTCCGGGGCCCGTCAGGGAGGTGCACGGAC
CTGGCGCGGCAAGCGGTGCGAATAGGCTTCCATGACGCGGCAGGATGGTCCAAGGCAACCGGGCCGCTCGGCGGTGCTGACGGGAGCATTGTCCTCGCGCCTGAGGAGATGACTCGGTCG
GCGAACCGCGGACTGGAGGACATCGTCGACCAGATGCAGGACTGGTTCGACGAGTACAGCCCGTACGGGGCCAGCATGGCCGATCTCATACAGATGGCGAGCACCACGGCCACAGTCGTG
TGTCCCCTTGGCCCTCGTGTCAGATCCTTCGTTGGCAGGAAAGACAGCTCCGTCCCGGCACCAGACGGCTTGCTCCCCAGCCCATTCGATAACGCTGACAAGCTCATCTCACTCTTCCAA
AACAAGACCATCGAGCCGCATGGGCTCACTGCTCTCTTGGGTGCTCACACCACGTCACAGCAACGGTTTGTGGACCCTGCGAGAGCAGGAGACCCCCAGGACAGCACCCCTGGTGTCTGG
GACGTTCTGTACTACAAGCAAACTCTCGACCCCAACGCCCCAAAGCGTGTGTTCAAGTTCCCCAGTGACATAAGCCTATCGCAAGACCCGAGGATCGCGCAGGAATTTCAGGAATTTGCA
GGACCTGGCGGACAGCAGCACTGGAACGAG
GACTACGCCCGGGAGTACGTGCGATTGAGCCTGCTGGGGGTCTTCAACATCAACAACCTGACGGAGTGCACAAAGGTCCTACCGCAGCCC
AGTGCGCCATTCTTCAACCCTCCCGATCAGCCTGTCCTGAACGTGTGGATGAATATCACCCGCCAAATTGAGCCATTCGCAAAGGCT
GTGTGCAGTCGACTGCTTCCCAAGGAGGTTCTG
GCCAACAAGGTGGGCATTCGACTGCTGCCCAAGGAGGTCGGAAGTCATGCAAGAGTTCCCGTAAGATGGTGA

Retrieve as FASTA