Entry information : MEspCIIAA03_NRRL54901
Entry ID 11764
Creation 2013-04-19 (Christophe Dunand)
Last sequence changes 2013-04-19 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-08-27 (Catherine Mathe)
Peroxidase information: MEspCIIAA03_NRRL54901
Name MEspCIIAA03_NRRL54901
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Melanconium sp. NRRL 54901    [TaxId: 1155951 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MEspCIIAA03_NRRL54901
start..stop
S start..stop
MEspCIIAA02_NRRL54901 472 5e-166 1..398 1..390
CgloCIIAA02_Naragc5 457 3e-160 21..426 17..420
CgloCIIAA02_ST23 457 3e-160 21..426 17..420
GgrCIIAA02 451 8e-158 22..407 18..415
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 242710..243726 1017 N° 2 242339..242626 288  
complement(join(242339..242626,242710..243726))


exon

Literature and cross-references MEspCIIAA03_NRRL54901
DNA ref. JGI genome:   scaffold_4 (243726..242339)
Cluster/Prediction ref. JGI gene:   108505
Protein sequence: MEspCIIAA03_NRRL54901
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   435 (413)
PWM (Da):   %s   46382.05 (44243.0) Transmb domain:   %s   o406-428i (o385-407i)
PI (pH):   %s   9.04 (9.00) Peptide Signal:   %s   cut: 22 range:22-434
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKFSAITIVCAGAAFIGNAVAHPGMAKVVNEIKANIMSRQGGPVDPALNSNELIGDLLTLQDSQLTPVGKDIKATILNQANGESLETYPSVPRLGTPQCKADTCCVWQYIANEMVTAFKGPSGRCTNAARAAIRLGFHDAAGWSKITGPDGGADGSLILNTEEIRRPGNRGLEEIVKLTQTWFAKYKGYGISAADLIQMGANVATVVCPLGPRTKTYVGRKDNPKPATDGLLPPVDATADFLIKLFQDKTIQPNGLVALLGAHSTAQQRFVDPRRAGDPQDSTPGVWDMLYYNDTINPNAPARVFKFPSDIKLAADPRMSRLFTAFAAPNNAAQLPWNLLYAREYVRLSLLGVNNINTLTDCTKVLPQPIRTFVPNDRCEVRTWMASTKNVPAIANALLDGKLITSIPGLSGLLSSIIGGILGLIGIGRQGSNC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCTCAGCCATCACTATTGTCTGCGCAGGCGCAGCCTTCATTGGCAACGCCGTAGCGCACCCTGGCATGGCCAAGGTCGTTAATGAGATCAAGGCCAACATCATGTCACGCCAA
GGTGGCCCCGTCGACCCGGCACTGAACTCCAACGAGCTCATCGGCGACCTCCTGACCTTACAGGACAGCCAGCTCACACCTGTTGGCAAGGATATCAAGGCCACAATCCTCAACCAAGCC
AACGGCGAGAGTTTGGAGACGTACCCCAGCGTTCCTAGGCTAGGCACACCACAGTGCAAGGCTGACACCTGCTGTGTATGGCAGTATATCGCCAACGAAATGGTCACAGCCTTCAAGGGT
CCGTCTGGCAGATGCACCAACGCGGCAAGAGCAGCCATCCGTCTTGGGTTCCATGACGCCGCCGGGTGGTCCAAAATTACAGGCCCGGACGGCGGCGCCGATGGCTCGCTCATCTTGAAC
ACGGAGGAGATCCGCCGACCAGGAAATCGCGGTCTCGAGGAGATCGTGAAGCTCACCCAGACCTGGTTCGCCAAGTACAAGGGCTATGGGATCTCTGCAGCAGACCTCATCCAGATGGGT
GCCAACGTGGCTACCGTGGTCTGTCCACTGGGCCCTCGCACCAAGACCTACGTCGGGCGCAAGGACAACCCAAAGCCCGCCACGGATGGCCTTCTCCCGCCTGTTGACGCCACCGCCGAC
TTCCTGATCAAGCTGTTTCAGGACAAGACCATCCAACCGAACGGTCTGGTCGCCCTTCTGGGTGCGCACTCCACAGCCCAGCAGCGGTTCGTCGACCCTCGCAGGGCCGGTGATCCACAG
GACAGCACTCCCGGTGTGTGGGATATGCTCTACTACAACGATACCATCAACCCGAACGCGCCCGCCCGTGTGTTCAAGTTCCCAAGCGACATCAAGTTGGCGGCAGACCCCAGGATGAGC
AGGCTGTTCACTGCCTTTGCCGCGCCCAACAACGCCGCGCAGCTGCCGTGGAACCTG
GTAAGTGTAGACCCCCAAGAAGGCAGCCAGAGCAGCCCAGGAAAACCTGCTTGCTAACGCGAA
GCCCCGTGCGTGTCTGACAGCTCTATGCCCGCGAGTATGTGCGCCTCAGCCTGCTGGGCGTCAACAACATCAACACGCTCACGGACTGCACCAAGGTGCTGCCCCAACCCATCAGGACGT
TTGTGCCCAACGACAGGTGCGAGGTCAGGACGTGGATGGCGTCCACAAAGAATGTGCCGGCCATCGCCAACGCGCTCCTGGACGGCAAGCTTATCACCTCCATCCCGGGCCTGTCGGGCC
TCCTGAGCAGCATAATCGGTGGAATTCTTGGGCTCATCGGCATTGGCCGCCAGGGCTCAAACTGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCTCAGCCATCACTATTGTCTGCGCAGGCGCAGCCTTCATTGGCAACGCCGTAGCGCACCCTGGCATGGCCAAGGTCGTTAATGAGATCAAGGCCAACATCATGTCACGCCAA
GGTGGCCCCGTCGACCCGGCACTGAACTCCAACGAGCTCATCGGCGACCTCCTGACCTTACAGGACAGCCAGCTCACACCTGTTGGCAAGGATATCAAGGCCACAATCCTCAACCAAGCC
AACGGCGAGAGTTTGGAGACGTACCCCAGCGTTCCTAGGCTAGGCACACCACAGTGCAAGGCTGACACCTGCTGTGTATGGCAGTATATCGCCAACGAAATGGTCACAGCCTTCAAGGGT
CCGTCTGGCAGATGCACCAACGCGGCAAGAGCAGCCATCCGTCTTGGGTTCCATGACGCCGCCGGGTGGTCCAAAATTACAGGCCCGGACGGCGGCGCCGATGGCTCGCTCATCTTGAAC
ACGGAGGAGATCCGCCGACCAGGAAATCGCGGTCTCGAGGAGATCGTGAAGCTCACCCAGACCTGGTTCGCCAAGTACAAGGGCTATGGGATCTCTGCAGCAGACCTCATCCAGATGGGT
GCCAACGTGGCTACCGTGGTCTGTCCACTGGGCCCTCGCACCAAGACCTACGTCGGGCGCAAGGACAACCCAAAGCCCGCCACGGATGGCCTTCTCCCGCCTGTTGACGCCACCGCCGAC
TTCCTGATCAAGCTGTTTCAGGACAAGACCATCCAACCGAACGGTCTGGTCGCCCTTCTGGGTGCGCACTCCACAGCCCAGCAGCGGTTCGTCGACCCTCGCAGGGCCGGTGATCCACAG
GACAGCACTCCCGGTGTGTGGGATATGCTCTACTACAACGATACCATCAACCCGAACGCGCCCGCCCGTGTGTTCAAGTTCCCAAGCGACATCAAGTTGGCGGCAGACCCCAGGATGAGC
AGGCTGTTCACTGCCTTTGCCGCGCCCAACAACGCCGCGCAGCTGCCGTGGAACCTG
CTCTATGCCCGCGAGTATGTGCGCCTCAGCCTGCTGGGCGTCAACAACATCAACACGCTCACG
GACTGCACCAAGGTGCTGCCCCAACCCATCAGGACGTTTGTGCCCAACGACAGGTGCGAGGTCAGGACGTGGATGGCGTCCACAAAGAATGTGCCGGCCATCGCCAACGCGCTCCTGGAC
GGCAAGCTTATCACCTCCATCCCGGGCCTGTCGGGCCTCCTGAGCAGCATAATCGGTGGAATTCTTGGGCTCATCGGCATTGGCCGCCAGGGCTCAAACTGCTGA

Retrieve as FASTA