Entry information : MEspCP02_NRRL54901
Entry ID 11767
Creation 2013-04-19 (Christophe Dunand)
Last sequence changes 2013-04-19 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-08-27 (Catherine Mathe)
Peroxidase information: MEspCP02_NRRL54901
Name MEspCP02_NRRL54901
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Melanconium sp. NRRL 54901    [TaxId: 1155951 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MEspCP02_NRRL54901
start..stop
S start..stop
CparCP02 1158 0 15..776 13..785
CfioCP02_PJ7 997 0 19..778 17..776
CfioCP02_MH18 997 0 19..778 17..776
NhaeCP02 996 0 14..777 9..779
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 232348..232663 316 N° 2 232729..233361 633 N° 3 233426..233833 408 N° 4 233904..234883 980
join(232348..232663,232729..233361,233426..233833,233904..234883)


exon

Literature and cross-references MEspCP02_NRRL54901
DNA ref. JGI genome:   scaffold_19 (232348..234883)
Cluster/Prediction ref. JGI gene:   95208
Protein sequence: MEspCP02_NRRL54901
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   779 (755)
PWM (Da):   %s   84634.02 (82230.7)  
PI (pH):   %s   5.1 (5.03) Peptide Signal:   %s   cut: 24 range:24-778
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSGSPSVPDILRALLLASPLVSAASCPFAQQQQKRDSSEFLNRRQDSSATPFGTCAEKANVAGGGTRSRDWFPCQLRLDVLRQNTAEINPYGADFNYAQAFNSLDFDAVKADLKALLRDSQDFWPADFGHYGGLFIRMAWHSAGTYRAFDGRGGSGMGQQRFSPLNSWPDNASLDKARRLVWPIKQKYGRKISWGDLIILAGNVALEDMGFPTFGYGGGRVDTWQADEAIYWGSEETFFPKGNSDRYNGSTDASARAEHLEVPLAATNMGLIYVNPEGPDANADPVSSALDIRTTFGRMGMNDQETVALIAGGHAFGKTHGAFDGSEIGGAPEAADLGEQQLGWAGSFKEGTGSFTSGLEVTWSKTPTKWSNDFLQSLFHNEWSLVKSPGGAHQWEALNATANYPLPFDNSSFQKPRMLTSDLALRHDPIYANIAQVYLANFTKLTEDFSRAWYKLTHRDMGPLARYLGPEVAREKLIWQDPLPDSNGTTIDYSDITTLKQQILGSGVSTSALISTAWASASTFRNTDKRGGANGARIRLEPQINWAVNTGAGTNLSDVLSALERIQSAYSKPVSMADLIVLGGSAAVEKAARDAGYAKASVPFTPGRVDATQDQTDVANFAYLEPKADGFRNFGRGNARARTEEILVDRANLLGLTPPELTVLVGGLRVLNTNADGSSHGVLTDKPGQLTNDWFVNLLDIQTKWADADSGEIWQGTDRKTGADKWTATRADLVFGSQSELRAIAEVYAMADSGEKFINDFVAAWNKVMNADRFDIKK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGGGTCACCGTCCGTGCCGGATATCCTCCGGGCTCTCCTCCTGGCTTCGCCCCTGGTGTCTGCTGCTTCCTGCCCGTTTGCTCAGCAACAACAGAAGAGGGACTCGTCTGAATTC
CTCAACCGTCGTCAAGACTCGTCTGCCACTCCATTTGGCACGTGCGCTGAAAAGGCCAATGTCGCCGGAGGTGGCACCCGCAGTAGAGACTGGTTCCCCTGTCAGCTACGACTCGATGTC
CTTCGCCAGAACACCGCCGAGATCAACCCATACGGCGCTGACTTCAATTATGCCCAAGCGTTCAACTCCCTGGATT
GTGAGCCACTTGCCCTGCCAGTTATTAAGCAAAGCTTTTCAGAC
CCCCAACTGACCATATACCAGTCGATGCTGTCAAGGCCGACCTCAAGGCCCTGCTAAGGGACTCGCAAGACTTTTGGCCAGCTGACTTCGGTCACTATGGCGGCCTGTTCATCCGTATGG
CATGGCACAGCGCAGGCACATACCGGGCCTTCGATGGCCGCGGGGGGTCTGGTATGGGCCAGCAGCGCTTCTCACCGCTTAACAGCTGGCCCGACAATGCCAGTCTTGACAAGGCCCGGC
GGCTGGTCTGGCCTATCAAGCAGAAGTATGGCCGCAAGATCTCGTGGGGCGACCTCATTATCCTCGCCGGAAACGTGGCGCTCGAGGATATGGGCTTCCCAACCTTTGGCTACGGTGGTG
GCCGCGTTGATACGTGGCAGGCCGACGAGGCCATCTACTGGGGCTCCGAGGAGACCTTTTTCCCCAAGGGTAACTCGGACCGCTACAACGGCAGCACCGACGCCAGCGCCCGCGCTGAGC
ACCTCGAGGTGCCCCTGGCGGCTACAAACATGGGCCTCATCTATGTGAACCCTGAGGGCCCAGACGCCAATGCCGACCCTGTCTCCTCCGCTCTCGATATCCGCACCACCTTCGGGAGAA
TGGGCATGAACGACCAGGAGACGGTGGCTCTGATTGCCGGCGGCCACGCTTTCG
GTATGTTTCCCTTCCCAGCACAGTGTTCCACGAGGATAACCTACTGACTCGCCGCCCATTACAGGC
AAAACACACGGGGCCTTCGACGGCAGCGAAATAGGAGGCGCACCCGAGGCTGCTGACCTCGGCGAGCAACAGCTCGGGTGGGCTGGCAGCTTCAAGGAGGGCACCGGCTCCTTCACATCG
GGGCTCGAGGTCACTTGGAGCAAGACGCCCACCAAGTGGTCCAACGACTTCCTACAGTCTCTGTTCCACAACGAGTGGTCCCTTGTTAAGAGCCCCGGCGGCGCCCACCAGTGGGAGGCC
CTCAACGCCACCGCCAACTACCCTCTTCCATTTGACAACAGCAGCTTCCAGAAGCCGAGGATGCTTACCAGCGATCTGGCTCTCCGACATGACCCCATCTATGCCAACATTGCCCAAGTT
TACCTGGCCAACTTCACCAAGCTGACTGAGGATTTTTCCCGTGCCT
GTAAGCCCATACCATGTCACCAGTATTGCCACCATCATGACACCGGAAACTAATGTTGTTTTGTGCACAGGGTA
CAAACTCACTCACCGTGACATGGGCCCTTTGGCCCGTTACCTTGGCCCAGAAGTCGCCAGGGAGAAGCTTATCTGGCAAGACCCTCTTCCCGACTCGAACGGTACTACCATTGACTACTC
CGATATCACTACCCTGAAGCAGCAGATCCTGGGTTCTGGTGTTAGCACCTCAGCCCTCATCTCCACGGCTTGGGCCTCGGCCAGCACTTTCCGCAATACGGACAAGCGCGGAGGCGCCAA
CGGAGCCCGCATCCGCCTCGAGCCCCAGATCAACTGGGCCGTGAACACCGGAGCCGGCACGAACCTGTCCGACGTCCTCAGCGCCCTCGAGCGCATCCAGTCGGCATATTCTAAGCCCGT
CTCCATGGCCGACCTGATCGTCCTGGGCGGATCGGCGGCTGTCGAGAAGGCAGCCAGGGATGCTGGGTACGCCAAGGCCTCCGTGCCATTCACCCCTGGCCGTGTCGACGCCACTCAGGA
CCAGACCGACGTTGCCAACTTCGCTTACCTGGAGCCCAAAGCCGACGGTTTCCGCAACTTCGGACGTGGCAACGCTCGCGCTCGGACTGAGGAGATCCTTGTCGACCGGGCCAACCTGCT
CGGTCTGACGCCGCCGGAGCTCACAGTTCTGGTGGGAGGTCTCCGCGTGCTCAACACCAATGCCGACGGGTCTTCCCATGGCGTTTTGACCGACAAGCCCGGCCAGCTGACCAACGACTG
GTTCGTCAACTTGCTCGACATCCAGACCAAGTGGGCCGACGCCGACAGCGGCGAGATCTGGCAGGGCACCGACCGCAAGACAGGCGCCGACAAGTGGACGGCCACCCGTGCTGATCTCGT
CTTTGGTTCGCAGTCTGAGCTGCGTGCCATCGCAGAGGTGTACGCCATGGCCGATTCGGGCGAGAAGTTCATCAATGACTTCGTGGCAGCTTGGAACAAGGTCATGAATGCCGATCGCTT
TGATATTAAGAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGGGTCACCGTCCGTGCCGGATATCCTCCGGGCTCTCCTCCTGGCTTCGCCCCTGGTGTCTGCTGCTTCCTGCCCGTTTGCTCAGCAACAACAGAAGAGGGACTCGTCTGAATTC
CTCAACCGTCGTCAAGACTCGTCTGCCACTCCATTTGGCACGTGCGCTGAAAAGGCCAATGTCGCCGGAGGTGGCACCCGCAGTAGAGACTGGTTCCCCTGTCAGCTACGACTCGATGTC
CTTCGCCAGAACACCGCCGAGATCAACCCATACGGCGCTGACTTCAATTATGCCCAAGCGTTCAACTCCCTGGATT
TCGATGCTGTCAAGGCCGACCTCAAGGCCCTGCTAAGGGACTCG
CAAGACTTTTGGCCAGCTGACTTCGGTCACTATGGCGGCCTGTTCATCCGTATGGCATGGCACAGCGCAGGCACATACCGGGCCTTCGATGGCCGCGGGGGGTCTGGTATGGGCCAGCAG
CGCTTCTCACCGCTTAACAGCTGGCCCGACAATGCCAGTCTTGACAAGGCCCGGCGGCTGGTCTGGCCTATCAAGCAGAAGTATGGCCGCAAGATCTCGTGGGGCGACCTCATTATCCTC
GCCGGAAACGTGGCGCTCGAGGATATGGGCTTCCCAACCTTTGGCTACGGTGGTGGCCGCGTTGATACGTGGCAGGCCGACGAGGCCATCTACTGGGGCTCCGAGGAGACCTTTTTCCCC
AAGGGTAACTCGGACCGCTACAACGGCAGCACCGACGCCAGCGCCCGCGCTGAGCACCTCGAGGTGCCCCTGGCGGCTACAAACATGGGCCTCATCTATGTGAACCCTGAGGGCCCAGAC
GCCAATGCCGACCCTGTCTCCTCCGCTCTCGATATCCGCACCACCTTCGGGAGAATGGGCATGAACGACCAGGAGACGGTGGCTCTGATTGCCGGCGGCCACGCTTTCG
GCAAAACACAC
GGGGCCTTCGACGGCAGCGAAATAGGAGGCGCACCCGAGGCTGCTGACCTCGGCGAGCAACAGCTCGGGTGGGCTGGCAGCTTCAAGGAGGGCACCGGCTCCTTCACATCGGGGCTCGAG
GTCACTTGGAGCAAGACGCCCACCAAGTGGTCCAACGACTTCCTACAGTCTCTGTTCCACAACGAGTGGTCCCTTGTTAAGAGCCCCGGCGGCGCCCACCAGTGGGAGGCCCTCAACGCC
ACCGCCAACTACCCTCTTCCATTTGACAACAGCAGCTTCCAGAAGCCGAGGATGCTTACCAGCGATCTGGCTCTCCGACATGACCCCATCTATGCCAACATTGCCCAAGTTTACCTGGCC
AACTTCACCAAGCTGACTGAGGATTTTTCCCGTGCCT
GGTACAAACTCACTCACCGTGACATGGGCCCTTTGGCCCGTTACCTTGGCCCAGAAGTCGCCAGGGAGAAGCTTATCTGGCAA
GACCCTCTTCCCGACTCGAACGGTACTACCATTGACTACTCCGATATCACTACCCTGAAGCAGCAGATCCTGGGTTCTGGTGTTAGCACCTCAGCCCTCATCTCCACGGCTTGGGCCTCG
GCCAGCACTTTCCGCAATACGGACAAGCGCGGAGGCGCCAACGGAGCCCGCATCCGCCTCGAGCCCCAGATCAACTGGGCCGTGAACACCGGAGCCGGCACGAACCTGTCCGACGTCCTC
AGCGCCCTCGAGCGCATCCAGTCGGCATATTCTAAGCCCGTCTCCATGGCCGACCTGATCGTCCTGGGCGGATCGGCGGCTGTCGAGAAGGCAGCCAGGGATGCTGGGTACGCCAAGGCC
TCCGTGCCATTCACCCCTGGCCGTGTCGACGCCACTCAGGACCAGACCGACGTTGCCAACTTCGCTTACCTGGAGCCCAAAGCCGACGGTTTCCGCAACTTCGGACGTGGCAACGCTCGC
GCTCGGACTGAGGAGATCCTTGTCGACCGGGCCAACCTGCTCGGTCTGACGCCGCCGGAGCTCACAGTTCTGGTGGGAGGTCTCCGCGTGCTCAACACCAATGCCGACGGGTCTTCCCAT
GGCGTTTTGACCGACAAGCCCGGCCAGCTGACCAACGACTGGTTCGTCAACTTGCTCGACATCCAGACCAAGTGGGCCGACGCCGACAGCGGCGAGATCTGGCAGGGCACCGACCGCAAG
ACAGGCGCCGACAAGTGGACGGCCACCCGTGCTGATCTCGTCTTTGGTTCGCAGTCTGAGCTGCGTGCCATCGCAGAGGTGTACGCCATGGCCGATTCGGGCGAGAAGTTCATCAATGAC
TTCGTGGCAGCTTGGAACAAGGTCATGAATGCCGATCGCTTTGATATTAAGAAGTGA

Retrieve as FASTA