Entry information : MEspCIIAB01_NRRL54901
Entry ID 11768
Creation 2013-04-19 (Christophe Dunand)
Last sequence changes 2013-04-19 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-08-27 (Catherine Mathe)
Peroxidase information: MEspCIIAB01_NRRL54901
Name MEspCIIAB01_NRRL54901
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Melanconium sp. NRRL 54901    [TaxId: 1155951 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MEspCIIAB01_NRRL54901
start..stop
S start..stop
CparCIIAB01 236 8e-78 20..264 49..282
HEC38CIIAB01 233 8e-77 14..264 18..266
CparCIIAB02 221 3e-72 12..261 3..247
HCO27CIIAB01 220 1e-71 14..264 18..266
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 541410..541734 325 N° 2 540953..541343 391 N° 3 540709..540829 121  
complement(join(540709..540829,540953..541343,541410..541734))


exon

Literature and cross-references MEspCIIAB01_NRRL54901
DNA ref. JGI genome:   scaffold_9 (541734..540709)
Cluster/Prediction ref. JGI gene:   17825
Protein sequence: MEspCIIAB01_NRRL54901
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   279 (260)
PWM (Da):   %s   30657.99 (28808.0)  
PI (pH):   %s   4.42 (4.36) Peptide Signal:   %s   cut: 19 range:19-278
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFAKGALVSFLLAGQAAAQCSETWNYVAQELKYAFIDDYGYCNNEARQGIRLPFHDCFPGGGCDGSIVLTDECFTRPENARLIPICALLRDVANRYQVGVADLINLAGAIGTKACKWGPYTPFYVGRTDNPTAAIQGQLPPPILQAPQLIDIFANRGFTSDELVALVGSHSAGKNHTGVPFDTTVSSLDSWTYYTETRELTAPATLPSDFFLSQYGQTRDAWNVFAVSQEAWDKEFVTGWKKLITLENDVTKLTDCTEIIFKAFPWGEDDPCEYSKTC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTGCAAAGGGCGCTCTCGTCTCTTTCCTCCTGGCCGGCCAAGCCGCCGCCCAGTGTTCTGAGACCTGGAACTACGTCGCTCAGGAGCTGAAGTATGCGTTCATCGATGACTACGGT
TACTGCAACAATGAGGCCCGCCAGGGTATCCGCCTGCCCTTCCATGACTGCTTCCCGGGAGGAGGCTGTGACGGCTCCATCGTTCTCACCGATGAATGCTTCACCCGCCCTGAAAATGCG
AGGCTCATCCCCATCTGCGCCTTGCTCCGCGATGTAGCCAACAGGTACCAGGTCGGTGTAGCTGATCTGATTAACCTGGCTGGTG
GTGAGTACAACCTTGAGGATCATGTCAGGTAATAG
AACACCCGTCAAGATGCTGACACCTCTAAAGCCATCGGCACCAAGGCCTGCAAATGGGGCCCATACACGCCCTTCTACGTCGGGCGCACTGACAACCCGACGGCGGCCATTCAGGGCCAG
CTGCCGCCACCCATCCTGCAGGCTCCGCAGCTGATCGATATCTTCGCCAACAGGGGCTTCACCTCCGACGAGCTGGTCGCACTGGTCGGCTCGCACAGCGCTGGCAAGAACCACACCGGT
GTGCCTTTTGATACCACCGTCAGCTCGCTCGACTCGTGGACCTACTACACCGAGACCCGCGAGCTCACGGCCCCGGCCACGCTGCCCAGCGATTTCTTCCTGTCGCAGTACGGCCAGACT
CGTGACGCTTGGAACGTCTTCGCCGTGAGCCAGGAAGCTTGGGACAAGGAATTTGTGACGGG
GTATGTTGTTTCTATTATCTCTGTTCACTAGCTTACCCTCTTGTGACATGCTTTCTCC
GCGGTACCCTCTAAGGTTACCCATGTAAAGTTGTCCTGAAAATAAGCTGACGTCGTAACCCGCAGCTGGAAGAAGTTGATCACTTTGGAAAATGATGTCACAAAGCTGACTGACTGCACC
GAGATCATTTTCAAGGCCTTCCCGTGGGGCGAGGATGACCCGTGCGAGTATTCAAAGACCTGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTGCAAAGGGCGCTCTCGTCTCTTTCCTCCTGGCCGGCCAAGCCGCCGCCCAGTGTTCTGAGACCTGGAACTACGTCGCTCAGGAGCTGAAGTATGCGTTCATCGATGACTACGGT
TACTGCAACAATGAGGCCCGCCAGGGTATCCGCCTGCCCTTCCATGACTGCTTCCCGGGAGGAGGCTGTGACGGCTCCATCGTTCTCACCGATGAATGCTTCACCCGCCCTGAAAATGCG
AGGCTCATCCCCATCTGCGCCTTGCTCCGCGATGTAGCCAACAGGTACCAGGTCGGTGTAGCTGATCTGATTAACCTGGCTGGTG
CCATCGGCACCAAGGCCTGCAAATGGGGCCCATAC
ACGCCCTTCTACGTCGGGCGCACTGACAACCCGACGGCGGCCATTCAGGGCCAGCTGCCGCCACCCATCCTGCAGGCTCCGCAGCTGATCGATATCTTCGCCAACAGGGGCTTCACCTCC
GACGAGCTGGTCGCACTGGTCGGCTCGCACAGCGCTGGCAAGAACCACACCGGTGTGCCTTTTGATACCACCGTCAGCTCGCTCGACTCGTGGACCTACTACACCGAGACCCGCGAGCTC
ACGGCCCCGGCCACGCTGCCCAGCGATTTCTTCCTGTCGCAGTACGGCCAGACTCGTGACGCTTGGAACGTCTTCGCCGTGAGCCAGGAAGCTTGGGACAAGGAATTTGTGACGGG
CTGG
AAGAAGTTGATCACTTTGGAAAATGATGTCACAAAGCTGACTGACTGCACCGAGATCATTTTCAAGGCCTTCCCGTGGGGCGAGGATGACCCGTGCGAGTATTCAAAGACCTGCTGA

Retrieve as FASTA