Entry information : MEspAPx-CcP02_NRRL54901
Entry ID 11770
Creation 2013-04-19 (Christophe Dunand)
Last sequence changes 2013-04-19 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-08-27 (Catherine Mathe)
Peroxidase information: MEspAPx-CcP02_NRRL54901
Name MEspAPx-CcP02_NRRL54901
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Melanconium sp. NRRL 54901    [TaxId: 1155951 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MEspAPx-CcP02_NRRL54901
start..stop
S start..stop
DescAPx-CcP02 590 0 21..539 10..535
HCO27APx-CcP03 585 0 22..541 21..547
AalcAPx-CcP 592 0 21..532 20..536
TaspAPx-CcP01 585 0 21..534 19..533
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 586370..587494 1125 N° 2 585593..586315 723  
complement(join(585593..586315,586370..587494))


exon

Literature and cross-references MEspAPx-CcP02_NRRL54901
DNA ref. JGI genome:   scaffold_20 (587494..585593)
Cluster/Prediction ref. JGI gene:   95523
Protein sequence: MEspAPx-CcP02_NRRL54901
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   616 (594)
PWM (Da):   %s   66404.91 (64098.6)  
PI (pH):   %s   4.78 (4.77) Peptide Signal:   %s   cut: 22 range:22-615
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRPILLEQAAAATALLSTVVADPTWPSPIDDLEEIMFQQRIFKSRNFADVISPCSNEASGPGRQVAAEWLRVAFHDMATADVRTGRGGLDGSLQYQLDDGESKGPGFNSTLKFFSDYLSRKSSLADLIALGVYASVRQCGGPVIPVRAGRVDAPGPGSTGVPQPEHSIEQFREQFSRMGFTNEEMIQLTACGHTIGGVHDTEFPELVKEGEAPSDSTVSMFDEKVITEYLENNTTNPLVVGPAVSEGKDSDAKIFGSDSNVTVKAMADPQNFQDVCRKVLQKMIEVVPKEVTLSQPINPYMIKPVDLRLSLGQAARHMQLSGNIRVRTTNLQSQEIAQMEIRFKNRHGEHECGAGSCLINATAQGNGFGLDDDFAFFPIDATIPIHKGISSFTVTLVLVNGTRMLFDNNGHDYPMQDAVILLRPQTCLLQYPGKINVTAAVRNDRNDLPTNLTISYKVPRPGLPVAGLHETTMAMTRGECVGPYTLYYAAWTIPGGISYSSRTDVSNGEGESLLMDEFTYGADLHGQCEEFPAPPASVCATLSITTTTSALKATSALTTDTLSGASATPSKAVSIPTAESGPEPTAGGHGFGKSIFRPVSESIWETFMQYLNTIW*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGACCGATTCTTCTTGAGCAAGCCGCGGCAGCAACCGCGCTGCTATCGACCGTCGTCGCCGATCCGACATGGCCGTCCCCAATCGATGACCTGGAAGAAATCATGTTCCAGCAGAGG
ATTTTCAAGTCGCGGAACTTTGCAGACGTCATCTCCCCATGTTCCAATGAGGCTTCCGGGCCTGGTAGGCAGGTCGCGGCTGAGTGGCTTAGGGTCGCATTTCATGACATGGCAACGGCA
GATGTCAGGACAGGGAGGGGGGGTTTGGACGGCTCGCTTCAGTACCAACTCGACGATGGGGAGAGCAAAGGACCGGGCTTCAATTCCACTCTCAAGTTCTTCTCTGATTACCTTTCAAGA
AAGTCGAGCCTGGCAGATCTGATCGCCCTCGGAGTGTACGCGTCGGTCCGCCAGTGTGGTGGGCCAGTCATACCTGTCAGGGCCGGCAGGGTGGATGCGCCAGGTCCTGGAAGCACAGGA
GTGCCTCAGCCAGAGCATTCGATCGAGCAGTTCCGCGAGCAGTTCTCCCGTATGGGCTTCACAAATGAGGAGATGATACAGCTAACGGCATGCGGGCATACGATCGGAGGAGTCCACGAT
ACCGAGTTCCCTGAGCTGGTCAAGGAGGGTGAGGCGCCATCTGACTCGACGGTGTCCATGTTTGACGAGAAGGTCATCACCGAGTACTTGGAAAATAATACAACAAACCCTCTCGTAGTA
GGGCCGGCTGTCAGCGAGGGTAAGGACTCGGATGCTAAAATCTTTGGGTCGGACTCCAACGTTACCGTCAAGGCTATGGCCGATCCACAGAATTTCCAGGATGTCTGCCGTAAGGTCCTT
CAGAAGATGATTGAGGTAGTCCCAAAAGAAGTCACCCTTTCGCAGCCCATCAATCCATATATGATCAAGCCGGTAGACTTGCGACTTTCCCTTGGGCAGGCAGCGAGGCATATGCAACTC
AGTGGCAACATACGTGTGAGGACTACCAATCTGCAAAGCCAGGAGATTGCGCAGATGGAGATCCGCTTCAAGAATCGGCATGGTGAACATGAGTGTGGCGCTGGGTCCTGCCTGATAAAT
GCAACTGCTCAAGGCAATGGCTTCGGACTGGACGACGACTTCGCA
GTGAGTGCATTTTGCTATGGTGTGGGCGACATTCGTGCTGACGACCAGCTGCAGTTCTTCCCAATCGACGCGACG
ATCCCGATTCACAAGGGCATCTCATCCTTTACTGTAACCCTTGTCCTGGTCAACGGGACACGCATGCTCTTTGACAACAACGGCCACGACTACCCAATGCAGGACGCCGTCATCCTCCTC
AGGCCGCAGACCTGCCTCCTGCAATACCCTGGGAAGATCAACGTCACGGCAGCCGTCCGTAACGACAGGAACGACCTTCCCACAAACCTCACAATCTCCTATAAGGTGCCACGACCGGGC
CTGCCCGTCGCCGGCCTTCATGAGACGACCATGGCCATGACCAGGGGCGAATGCGTCGGCCCGTACACACTGTATTACGCCGCATGGACCATACCAGGGGGTATTAGCTACTCCTCCCGG
ACCGACGTCAGCAATGGAGAAGGCGAGAGCCTGCTCATGGATGAATTTACCTATGGGGCCGACCTGCATGGTCAATGTGAAGAGTTCCCCGCCCCGCCGGCGTCTGTCTGTGCGACCTTG
AGCATCACCACCACTACTTCGGCGCTGAAGGCAACTTCTGCTCTCACCACGGATACTCTTTCAGGGGCCTCGGCTACACCATCGAAGGCAGTGTCGATTCCAACAGCTGAGTCTGGTCCA
GAGCCCACAGCGGGCGGTCACGGGTTCGGCAAGTCCATCTTTCGACCGGTATCTGAGAGCATATGGGAGACATTTATGCAGTATCTTAATACTATATGGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGACCGATTCTTCTTGAGCAAGCCGCGGCAGCAACCGCGCTGCTATCGACCGTCGTCGCCGATCCGACATGGCCGTCCCCAATCGATGACCTGGAAGAAATCATGTTCCAGCAGAGG
ATTTTCAAGTCGCGGAACTTTGCAGACGTCATCTCCCCATGTTCCAATGAGGCTTCCGGGCCTGGTAGGCAGGTCGCGGCTGAGTGGCTTAGGGTCGCATTTCATGACATGGCAACGGCA
GATGTCAGGACAGGGAGGGGGGGTTTGGACGGCTCGCTTCAGTACCAACTCGACGATGGGGAGAGCAAAGGACCGGGCTTCAATTCCACTCTCAAGTTCTTCTCTGATTACCTTTCAAGA
AAGTCGAGCCTGGCAGATCTGATCGCCCTCGGAGTGTACGCGTCGGTCCGCCAGTGTGGTGGGCCAGTCATACCTGTCAGGGCCGGCAGGGTGGATGCGCCAGGTCCTGGAAGCACAGGA
GTGCCTCAGCCAGAGCATTCGATCGAGCAGTTCCGCGAGCAGTTCTCCCGTATGGGCTTCACAAATGAGGAGATGATACAGCTAACGGCATGCGGGCATACGATCGGAGGAGTCCACGAT
ACCGAGTTCCCTGAGCTGGTCAAGGAGGGTGAGGCGCCATCTGACTCGACGGTGTCCATGTTTGACGAGAAGGTCATCACCGAGTACTTGGAAAATAATACAACAAACCCTCTCGTAGTA
GGGCCGGCTGTCAGCGAGGGTAAGGACTCGGATGCTAAAATCTTTGGGTCGGACTCCAACGTTACCGTCAAGGCTATGGCCGATCCACAGAATTTCCAGGATGTCTGCCGTAAGGTCCTT
CAGAAGATGATTGAGGTAGTCCCAAAAGAAGTCACCCTTTCGCAGCCCATCAATCCATATATGATCAAGCCGGTAGACTTGCGACTTTCCCTTGGGCAGGCAGCGAGGCATATGCAACTC
AGTGGCAACATACGTGTGAGGACTACCAATCTGCAAAGCCAGGAGATTGCGCAGATGGAGATCCGCTTCAAGAATCGGCATGGTGAACATGAGTGTGGCGCTGGGTCCTGCCTGATAAAT
GCAACTGCTCAAGGCAATGGCTTCGGACTGGACGACGACTTCGCA
TTCTTCCCAATCGACGCGACGATCCCGATTCACAAGGGCATCTCATCCTTTACTGTAACCCTTGTCCTGGTCAAC
GGGACACGCATGCTCTTTGACAACAACGGCCACGACTACCCAATGCAGGACGCCGTCATCCTCCTCAGGCCGCAGACCTGCCTCCTGCAATACCCTGGGAAGATCAACGTCACGGCAGCC
GTCCGTAACGACAGGAACGACCTTCCCACAAACCTCACAATCTCCTATAAGGTGCCACGACCGGGCCTGCCCGTCGCCGGCCTTCATGAGACGACCATGGCCATGACCAGGGGCGAATGC
GTCGGCCCGTACACACTGTATTACGCCGCATGGACCATACCAGGGGGTATTAGCTACTCCTCCCGGACCGACGTCAGCAATGGAGAAGGCGAGAGCCTGCTCATGGATGAATTTACCTAT
GGGGCCGACCTGCATGGTCAATGTGAAGAGTTCCCCGCCCCGCCGGCGTCTGTCTGTGCGACCTTGAGCATCACCACCACTACTTCGGCGCTGAAGGCAACTTCTGCTCTCACCACGGAT
ACTCTTTCAGGGGCCTCGGCTACACCATCGAAGGCAGTGTCGATTCCAACAGCTGAGTCTGGTCCAGAGCCCACAGCGGGCGGTCACGGGTTCGGCAAGTCCATCTTTCGACCGGTATCT
GAGAGCATATGGGAGACATTTATGCAGTATCTTAATACTATATGGTAG

Retrieve as FASTA