Entry information : MEspAPx-CcP03_NRRL54901
Entry ID 11771
Creation 2013-04-19 (Christophe Dunand)
Last sequence changes 2013-04-19 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-08-27 (Catherine Mathe)
Peroxidase information: MEspAPx-CcP03_NRRL54901
Name MEspAPx-CcP03_NRRL54901
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Melanconium sp. NRRL 54901    [TaxId: 1155951 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MEspAPx-CcP03_NRRL54901
start..stop
S start..stop
TmiAPx-CcP_UCR-PA7 923 0 5..801 16..816
TmiAPx-CcP_UCR-PA7 232 7e-65 603..804 736..926
TmiAPx-CcP_UCR-PA7 113 7e-26 701..803 600..701
TmiAPx-CcP_UCR-PA7 112 1e-25 595..683 836..924
TaspAPx-CcP01 833 0 8..801 18..798
TaspAPx-CcP01 233 4e-65 570..804 689..907
TaspAPx-CcP01 112 7e-26 588..688 810..910
SmaAPx-CcP01 825 0 9..802 21..820
TatAPx-CcP01 825 0 8..801 18..808
TatAPx-CcP01 220 1e-60 570..804 699..917
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5128224..5128415 192 N° 2 5126428..5128162 1735 N° 3 5125996..5126352 357 N° 4 5125795..5125925 131
complement(join(5125795..5125925,5125996..5126352,5126428..5128162,5128224..5128 415))


exon

Literature and cross-references MEspAPx-CcP03_NRRL54901
DNA ref. JGI genome:   scaffold_1 (5128415..5125795)
Cluster/Prediction ref. JGI gene:   72863
Protein sequence: MEspAPx-CcP03_NRRL54901
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   805
PWM (Da):   %s   82311.12  
PI (pH):   %s   4.29
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MCLAAGVRADPTWPAATDEIEEIMYQLYGSRARLFADTITPCSKEAHGVGRKTASEWLRVAFHDMATANTFFGIGGIDASIMYELRNGENLGPGLNTSLITYADYFSPRSTMSDLIALGGSLATRVCGGPAVPVRGGRVDATSAGSPGVPQPQNAISLFINQFQRMGFTQSEMIGLVACGHTLGGVHTTEFPTLVPAGTAPNNESALDTTPEVFDNKVVTEYLDGTTKNPLVVGPSVALKQNADFVVYSSDSNATMKTLADPANFTATCASLLQRMIDVVPSGVALSDPILPYAVKPVDLGLTLNSGGETLSLSGGIRVRTTGLTQAVSSVTVAYKGRSGASCASCTISATAQGSGSGLDDTFDYFTISADIPVVSGISSFTVTLGFADGTTELHDNNGNGYPISDAVVLQKSQSCLLQGPGSLNVSALVLSSLAAPVTLGIQYQTPQVGIAGPRLQKTSVAMAQGACVGPYTFYTASYTVPGGMSHAARLDVTSGSGTSAASDTFNLASDLGGTCVEFTGVSTCGSAPPTSSSAVSSTLSTVSVPTSSVGTSTSSTESVSYSVPSVTSSSTITASSSSTSAVATLAHKATVAGYELVSCWTEGTSVRALSASAYSDDSMTLESCAAFCAGYKYFGTEYGRECYCGNTLDPSTESAPLDDCNMVCSGSSVQYCGSGNRLELYFSNSTEPGNGEGGGGSGGDGGEPTQPETVGAYTAYGCVTEADQTRALGARSFVDAGMTLERCASFCSAYTYFGVEYARECYCGDTFAAGSVAAPATDCSMTCAGNTTQFCGGSNRLSAYQKS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Peroxidase domain fused to 2 WSC domains (putative carbohydrate binding domain).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGCCTCGCGGCAGGCGTCCGCGCGGATCCCACGTGGCCGGCGGCGACGGATGAGATAGAGGAGATAATGTACCAGCTCTACGGCTCCAGGGCGCGCCTGTTCGCAGACACCATCACG
CCCTGCTCAAAAGAAGCACATGGGGTGGGGAGGAAGACAGCCTCGGAGTGGCTCCGGGTGGCATTTCACGAT
GTAAGGCGACGACCGTGCCTCTCCCAAGGAGATTAACTGTATCTGATA
TGAGATGGCGCAGATGGCAACGGCGAACACGTTCTTCGGCATCGGCGGCATCGACGCCTCCATCATGTACGAGCTGAGAAACGGCGAGAACCTCGGCCCGGGGCTCAACACGAGCCTCAT
CACCTACGCCGACTACTTCTCCCCGCGCAGCACCATGTCAGACCTCATCGCGCTGGGGGGCTCGCTGGCGACGCGGGTCTGCGGCGGGCCGGCCGTGCCCGTCAGGGGCGGGCGGGTGGA
CGCCACGTCCGCCGGAAGCCCGGGGGTCCCGCAGCCGCAGAACGCAATTTCCTTGTTTATCAACCAGTTCCAGCGGATGGGGTTCACGCAGTCCGAAATGATCGGCCTGGTCGCCTGCGG
GCACACCCTCGGCGGCGTGCACACGACCGAGTTCCCAACCCTGGTCCCCGCGGGGACGGCGCCCAACAACGAGTCGGCACTGGACACAACTCCCGAGGTTTTCGATAACAAGGTTGTCAC
CGAGTACCTGGACGGGACGACCAAGAACCCGCTCGTCGTGGGGCCCTCGGTGGCGCTGAAACAAAACGCGGACTTTGTCGTCTACAGCTCGGACAGTAACGCCACGATGAAGACCCTCGC
GGACCCGGCCAACTTCACAGCCACCTGCGCGAGCCTTCTGCAGCGCATGATCGACGTCGTCCCGTCGGGCGTGGCCCTTTCCGACCCAATCCTGCCCTATGCCGTCAAGCCGGTCGACCT
GGGGCTCACCCTCAACAGCGGCGGCGAGACGCTTTCGCTGAGCGGTGGCATCCGCGTGCGGACGACAGGGCTCACACAGGCCGTCAGCAGCGTGACAGTGGCATACAAGGGCCGCAGCGG
TGCAAGCTGCGCCTCGTGCACCATCTCGGCGACCGCCCAGGGGTCCGGTTCTGGGCTGGACGACACCTTTGACTACTTCACCATCTCGGCCGACATCCCGGTGGTGTCAGGCATCTCGTC
CTTCACCGTGACGTTGGGTTTCGCCGACGGGACGACAGAGCTTCACGACAACAACGGCAACGGCTACCCCATCTCCGACGCCGTTGTCCTCCAGAAGTCGCAGAGCTGCCTCCTCCAAGG
GCCCGGCTCGTTGAACGTGTCAGCGCTCGTTCTCAGCAGCCTTGCGGCGCCAGTGACCCTGGGAATCCAGTACCAGACGCCGCAAGTCGGGATCGCTGGCCCACGGCTCCAAAAGACGAG
CGTGGCCATGGCGCAGGGCGCCTGTGTGGGGCCATACACGTTCTACACGGCGTCGTACACCGTCCCCGGGGGCATGTCCCACGCGGCACGGCTCGACGTCACGAGCGGCAGCGGCACCTC
CGCGGCGTCGGACACTTTCAACCTGGCATCCGACTTGGGCGGGACGTGTGTTGAGTTCACGGGTGTTTCTACGTGCGGCAGTGCACCTCCCACGTCATCCTCGGCGGTGAGCTCCACGCT
GTCCACTGTGTCCGTCCCGACCAGCTCGGTCGGCACTTCCACTTCGTCGACCGAGTCTGTCTCGTATTCTGTCCCGTCTGTGACAAGCTCTAGCACCATCACTGCAAGTTCATCTAGCAC
CTCCGCGGTTGCGACGTTGGCTCACAAGGCTACAGTAGCCGGATATGAACTCGTGTCCTGCTGGACGGAGGGCACCAGTGTGCGTGCTCTTTCAGCGTCGGCATACTCAGACGATAGCAT
GACCCTTGAGTCTTGCGCAGCGTTCTGCGCGGGTTACAAATATTTCGGGACCGAGTACGGAAGAGAAT
GTCAGTCCATCCTGTCTTTGATATGATGCCATGCCCTTACCTCTCTCGGCTC
GCCCGCTAATCTCCCTCCTGTAGGTTACTGTGGAAACACACTCGATCCCTCGACGGAGAGTGCCCCCTTGGATGACTGCAACATGGTCTGCTCGGGCTCCAGCGTCCAATACTGTGGCTC
TGGCAACCGGTTGGAGCTCTACTTCAGCAACAGTACCGAGCCGGGTAATGGTGAAGGGGGAGGAGGTAGTGGAGGCGACGGCGGGGAGCCAACACAACCGGAGACTGTAGGGGCGTATAC
GGCCTATGGTTGTGTGACCGAGGCGGACCAGACGAGGGCGCTGGGTGCGCGAAGCTTCGTGGATGCCGGGATGACGCTGGAGCGTTGTGCGAGTTTCTGCTCGGCATATACCTACTTTGG
TGTCGAGTACGCCCGCGAAT
GTGAGTTTCTGCCCACTTGGCAACAATGCTGCAGTCCGGTCTCTGTCAGAGATGCTAACATGTGTCATAGGCTATTGTGGTGACACTTTTGCGGCCGGCT
CGGTAGCTGCTCCAGCGACTGATTGCTCAATGACATGCGCGGGCAACACAACGCAGTTTTGTGGTGGCAGTAATAGGCTCAGCGCCTATCAGAAGTCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGCCTCGCGGCAGGCGTCCGCGCGGATCCCACGTGGCCGGCGGCGACGGATGAGATAGAGGAGATAATGTACCAGCTCTACGGCTCCAGGGCGCGCCTGTTCGCAGACACCATCACG
CCCTGCTCAAAAGAAGCACATGGGGTGGGGAGGAAGACAGCCTCGGAGTGGCTCCGGGTGGCATTTCACGAT
ATGGCAACGGCGAACACGTTCTTCGGCATCGGCGGCATCGACGCCTCC
ATCATGTACGAGCTGAGAAACGGCGAGAACCTCGGCCCGGGGCTCAACACGAGCCTCATCACCTACGCCGACTACTTCTCCCCGCGCAGCACCATGTCAGACCTCATCGCGCTGGGGGGC
TCGCTGGCGACGCGGGTCTGCGGCGGGCCGGCCGTGCCCGTCAGGGGCGGGCGGGTGGACGCCACGTCCGCCGGAAGCCCGGGGGTCCCGCAGCCGCAGAACGCAATTTCCTTGTTTATC
AACCAGTTCCAGCGGATGGGGTTCACGCAGTCCGAAATGATCGGCCTGGTCGCCTGCGGGCACACCCTCGGCGGCGTGCACACGACCGAGTTCCCAACCCTGGTCCCCGCGGGGACGGCG
CCCAACAACGAGTCGGCACTGGACACAACTCCCGAGGTTTTCGATAACAAGGTTGTCACCGAGTACCTGGACGGGACGACCAAGAACCCGCTCGTCGTGGGGCCCTCGGTGGCGCTGAAA
CAAAACGCGGACTTTGTCGTCTACAGCTCGGACAGTAACGCCACGATGAAGACCCTCGCGGACCCGGCCAACTTCACAGCCACCTGCGCGAGCCTTCTGCAGCGCATGATCGACGTCGTC
CCGTCGGGCGTGGCCCTTTCCGACCCAATCCTGCCCTATGCCGTCAAGCCGGTCGACCTGGGGCTCACCCTCAACAGCGGCGGCGAGACGCTTTCGCTGAGCGGTGGCATCCGCGTGCGG
ACGACAGGGCTCACACAGGCCGTCAGCAGCGTGACAGTGGCATACAAGGGCCGCAGCGGTGCAAGCTGCGCCTCGTGCACCATCTCGGCGACCGCCCAGGGGTCCGGTTCTGGGCTGGAC
GACACCTTTGACTACTTCACCATCTCGGCCGACATCCCGGTGGTGTCAGGCATCTCGTCCTTCACCGTGACGTTGGGTTTCGCCGACGGGACGACAGAGCTTCACGACAACAACGGCAAC
GGCTACCCCATCTCCGACGCCGTTGTCCTCCAGAAGTCGCAGAGCTGCCTCCTCCAAGGGCCCGGCTCGTTGAACGTGTCAGCGCTCGTTCTCAGCAGCCTTGCGGCGCCAGTGACCCTG
GGAATCCAGTACCAGACGCCGCAAGTCGGGATCGCTGGCCCACGGCTCCAAAAGACGAGCGTGGCCATGGCGCAGGGCGCCTGTGTGGGGCCATACACGTTCTACACGGCGTCGTACACC
GTCCCCGGGGGCATGTCCCACGCGGCACGGCTCGACGTCACGAGCGGCAGCGGCACCTCCGCGGCGTCGGACACTTTCAACCTGGCATCCGACTTGGGCGGGACGTGTGTTGAGTTCACG
GGTGTTTCTACGTGCGGCAGTGCACCTCCCACGTCATCCTCGGCGGTGAGCTCCACGCTGTCCACTGTGTCCGTCCCGACCAGCTCGGTCGGCACTTCCACTTCGTCGACCGAGTCTGTC
TCGTATTCTGTCCCGTCTGTGACAAGCTCTAGCACCATCACTGCAAGTTCATCTAGCACCTCCGCGGTTGCGACGTTGGCTCACAAGGCTACAGTAGCCGGATATGAACTCGTGTCCTGC
TGGACGGAGGGCACCAGTGTGCGTGCTCTTTCAGCGTCGGCATACTCAGACGATAGCATGACCCTTGAGTCTTGCGCAGCGTTCTGCGCGGGTTACAAATATTTCGGGACCGAGTACGGA
AGAGAAT
GTTACTGTGGAAACACACTCGATCCCTCGACGGAGAGTGCCCCCTTGGATGACTGCAACATGGTCTGCTCGGGCTCCAGCGTCCAATACTGTGGCTCTGGCAACCGGTTGGAG
CTCTACTTCAGCAACAGTACCGAGCCGGGTAATGGTGAAGGGGGAGGAGGTAGTGGAGGCGACGGCGGGGAGCCAACACAACCGGAGACTGTAGGGGCGTATACGGCCTATGGTTGTGTG
ACCGAGGCGGACCAGACGAGGGCGCTGGGTGCGCGAAGCTTCGTGGATGCCGGGATGACGCTGGAGCGTTGTGCGAGTTTCTGCTCGGCATATACCTACTTTGGTGTCGAGTACGCCCGC
GAAT
GCTATTGTGGTGACACTTTTGCGGCCGGCTCGGTAGCTGCTCCAGCGACTGATTGCTCAATGACATGCGCGGGCAACACAACGCAGTTTTGTGGTGGCAGTAATAGGCTCAGCGCC
TATCAGAAGTCCTGA

Retrieve as FASTA