Entry information : PcroGPx01
Entry ID 11775
Creation 2013-04-23 (Christophe Dunand)
Last sequence changes 2013-04-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: PcroGPx01
Name PcroGPx01
Class Fungi-Bacteria glutathione peroxidase    [Orthogroup: Gpx3001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Atheliaceae Piloderma
Organism Piloderma croceum    [TaxId: 80663 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcroGPx01
start..stop
S start..stop
DqueGPx01 286 2e-100 62..220 1..159
NlepGPx01 285 8e-99 34..220 35..216
BaGPx01 281 1e-97 13..220 3..213
PplGPx02 280 1e-96 26..220 39..236
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 727183..727472 290 N° 2 727532..727554 23 N° 3 727614..727681 68 N° 4 727738..727911 174
N° 5 727970..728074 105  
join(727183..727472,727532..727554,727614..727681,727738..727911,727970..728074)


exon

Literature and cross-references PcroGPx01
DNA ref. JGI genome:   scaffold_00019 (727183..728074)
Cluster/Prediction ref. JGI gene:   818716 [Incorrect prediction]
Protein sequence: PcroGPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   221
PWM (Da):   %s   24362.48  
PI (pH):   %s   8.84
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MITPTIPLLLRFSSRYYHISTPTPPLLSLLPPPSVSRAFPCSTRSNTTSSLSDTSPKTSSKMTTFYDLKADLPKGEKYDFTTLKGKVVLIVNTASACGFTPQYGLQALWNKYKDQDFVLLGFPCNFGGQEPGTDEEVAEFCTLNHGVDFPLMKKSDVNGDGTNEVYKYLKSQKTGLLGLSRIKWNFEKFLIDKEGNVVNRWASTTTPAAIDAEVAKLL

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). Incorrect prediction from JGI (5'end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATAACGCCCACAATCCCTTTATTACTGCGCTTTTCCAGCCGATACTATCACATCTCAACTCCCACCCCCCCTCTGCTCTCCCTTCTTCCTCCTCCTAGCGTCTCTCGCGCATTTCCT
TGTAGTACTCGTAGCAACACTACGTCATCCCTCTCAGATACAAGTCCAAAAACCAGCTCGAAAATGACCACATTCTACGACCTTAAGGCTGATTTGCCCAAGGGCGAGAAGTACGATTTT
ACTACCTTGAAGGGCAAGGTAGTATTGATAGTGAACACTGCTTCTGCATG
GTATGTCGTCCAATTCGCAAAAATCATGGCAGTGGTCTGATGAACGTATAAACACTCAGTGGTTTCACGC
CGCAATACAAGG
GTCCGCAGTCTGATTTGGATTTTCCCCCGCTTCATTTGTATTGACACCGCCTTTTGCAGGCTTGCAAGCACTATGGAACAAGTACAAGGATCAAGATTTCGTCCTGCT
CGGATTCCCTTGCAACCAG
GCGCGTGTACTGTTCAACTGACCCAAAATCTGATTTTCTGATTTTCCTGTCTACAGTTCGGCGGTCAAGAACCCGGCACGGATGAGGAGGTTGCCGAGTTC
TGCACTCTGAATCACGGGGTCGATTTCCCTTTGATGAAGAAATCAGATGTCAACGGCGACGGTACGAACGAAGTGTACAAATACTTGAAGTCACAGAAGACGGGATTGTTGGGGCTGTCC
AGGATTAAG
GTTGGTGGCTTATTACGCCTTTCTTCCTCTCAACTCCGACGCTGAATATCGTCGGCAGTGGAACTTCGAGAAATTCCTCATTGACAAGGAGGGCAATGTTGTCAACCGCTG
GGCTTCTACAACGACGCCCGCAGCTATCGATGCAGAGGTTGCGAAGCTTCTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATAACGCCCACAATCCCTTTATTACTGCGCTTTTCCAGCCGATACTATCACATCTCAACTCCCACCCCCCCTCTGCTCTCCCTTCTTCCTCCTCCTAGCGTCTCTCGCGCATTTCCT
TGTAGTACTCGTAGCAACACTACGTCATCCCTCTCAGATACAAGTCCAAAAACCAGCTCGAAAATGACCACATTCTACGACCTTAAGGCTGATTTGCCCAAGGGCGAGAAGTACGATTTT
ACTACCTTGAAGGGCAAGGTAGTATTGATAGTGAACACTGCTTCTGCATG
TGGTTTCACGCCGCAATACAAGGGCTTGCAAGCACTATGGAACAAGTACAAGGATCAAGATTTCGTCCTG
CTCGGATTCCCTTGCAACCAG
TTCGGCGGTCAAGAACCCGGCACGGATGAGGAGGTTGCCGAGTTCTGCACTCTGAATCACGGGGTCGATTTCCCTTTGATGAAGAAATCAGATGTCAAC
GGCGACGGTACGAACGAAGTGTACAAATACTTGAAGTCACAGAAGACGGGATTGTTGGGGCTGTCCAGGATTAAG
TGGAACTTCGAGAAATTCCTCATTGACAAGGAGGGCAATGTTGTC
AACCGCTGGGCTTCTACAACGACGCCCGCAGCTATCGATGCAGAGGTTGCGAAGCTTCTA

Retrieve as FASTA