Entry information : CfioCP01_MH18
Entry ID 11812
Creation 2013-04-29 (Christophe Dunand)
Last sequence changes 2013-04-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-20 (Christophe Dunand)
Peroxidase information: CfioCP01_MH18
Name CfioCP01_MH18
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioCP01_MH18
start..stop
S start..stop
CfioCP01_PJ7 1553 0 1..757 1..757
ChigCP01 1411 0 1..757 1..760
CgraCP01 1409 0 1..757 1..758
CgloCP02_Naragc5 1322 0 1..757 1..757
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 51610..51939 330 N° 2 49598..51541 1944  
complement(join(49598..51541,51610..51939))


exon

Literature and cross-references CfioCP01_MH18
DNA ref. JGI genome:   scaffold_29 (51939..49598)
Cluster/Prediction ref. JGI gene:   1314247
Protein sequence: CfioCP01_MH18
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   758
PWM (Da):   %s   82884.34  
PI (pH):   %s   6.09
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAEEKCPFIRTMNTGGGGTKNRDWWPDSLKLNILRQHTPVTNPLGGDFDYVSAFKTLDYDGVKKDLTALMTDSQDWWPADFGHYGGLFIRMAWHSAGTYRVHDGRGGGGEGQQRFAPLNSWPDNVSLDKARRLLWPIKQKYGNKISWADLMILAGNVALESMGFQTAGFSGGRPDTWEADESVYWGGETTWLGNDVRYSHGHEGKAEPGVLDGSQDTKSKSDIHTRDLESPLGAAHMGLIYVNPEGPDGNPDPVAAARDIRVTFGRMAMNDEETVALIAGGHTFGKTHGAAPDSNVGAEPEASGLEAQGFGWANKHGTGKGADTITSGLEVTWTATPTKWSNKYFEYLFKFDWELTKSPAGANQWVAKNAEPIIPHAFDSSKKQLPTMLTTDLSLRFDPEYEKISRRFLENPDQFADAFAKAWFKLTHRDMGPRSRYVGPEVPSEDFIWQDPIPAPSSPLVSEQDVAALKKEVLATGIDASKLISTAWASASTFRGSDKRGGANGARIRLAPQKDWEVNNPKQLAEVLKALEGVQQKFNGSGKKISLADLIVLAGAAGVEQAAKNAGVDINVPFTPGRGDATQEQTDVESVDHLQPYADGFRNYGKSSNRAKTEHYLVDKAHLLTLTAPELTVLVGGLRVLNTNFDGSSTGVFTNRPGALTNDFFVNLLDMGNEWKATNNQDVYEGFDRKSGSKKYTASRVDLVFGSHAELRAVAEIYAQADAGQKFVKDFVTVWDKVMNLDRFDLKKQSGSVPSRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGGAAAAGTGTCCCTTCATTCGGACCATGAACACCGGAGGTGGCGGCACAAAGAACCGCGACTGGTGGCCCGATTCCCTTAAGCTCAACATCCTCCGCCAGCACACTCCCGTC
ACCAACCCGTTAGGTGGTGACTTTGACTACGTGTCTGCCTTCAAGACCCTCGACTACGATGGCGTCAAGAAGGACCTCACGGCTCTGATGACCGACTCTCAAGATTGGTGGCCTGCCGAT
TTTGGCCATTACGGAGGTCTCTTCATTCGTATGGCATGGCACAGCGCCGGTACCTACCGTGTTCATGACGGCCGTGGCGGCGGCGGTGAG
GTAAGTTGATCCGGGAAACTAAACGGATCA
TCATTGGTAGACGAGGTGCTAATTATTGCGCCTTACAGGGTCAGCAACGTTTTGCCCCTCTCAATAGTTGGCCTGACAATGTCAGTCTCGACAAGGCCCGTCGCTTGTTATGGCCCATAA
AGCAAAAGTACGGCAACAAGATCTCCTGGGCCGATCTTATGATCTTGGCTGGCAACGTTGCCCTCGAGTCAATGGGCTTCCAGACTGCTGGTTTCTCTGGCGGACGTCCCGACACCTGGG
AGGCTGATGAGTCCGTTTACTGGGGCGGCGAGACCACATGGCTTGGCAACGACGTCCGCTACTCCCACGGTCACGAAGGGAAGGCCGAGCCGGGCGTCCTCGACGGCTCTCAGGACACCA
AGAGCAAGTCAGACATTCACACCCGCGACCTGGAGTCACCACTTGGTGCCGCCCATATGGGTCTCATTTATGTGAACCCTGAGGGTCCCGACGGCAACCCCGACCCAGTCGCCGCTGCTA
GAGACATTCGCGTCACTTTCGGACGCATGGCTATGAATGACGAGGAGACGGTGGCTCTCATCGCTGGTGGTCACACTTTCGGCAAGACCCACGGTGCTGCTCCCGACAGCAACGTTGGTG
CCGAGCCCGAGGCCTCTGGTCTCGAGGCTCAGGGCTTTGGCTGGGCCAACAAGCACGGTACCGGCAAGGGCGCGGATACCATCACCAGTGGTCTGGAGGTTACTTGGACTGCTACTCCCA
CCAAGTGGAGCAACAAGTACTTCGAGTACCTATTCAAATTTGACTGGGAGCTCACCAAGAGTCCCGCTGGTGCTAACCAGTGGGTGGCAAAGAACGCCGAGCCCATCATCCCCCATGCCT
TCGACTCCAGCAAGAAGCAGCTTCCCACCATGTTGACGACCGACTTGTCGCTGCGCTTCGACCCCGAATATGAGAAGATCTCGAGACGCTTCCTCGAAAACCCGGATCAGTTCGCCGATG
CATTCGCCAAGGCCTGGTTCAAGCTCACCCACCGTGACATGGGCCCGCGCTCCCGCTACGTTGGACCCGAGGTTCCCTCTGAGGATTTCATCTGGCAGGACCCCATCCCTGCTCCCAGCT
CGCCCCTCGTCAGCGAGCAGGACGTTGCTGCCCTCAAGAAGGAGGTTCTCGCCACTGGCATTGATGCCTCCAAGCTCATCTCCACTGCTTGGGCTTCAGCCTCTACCTTCCGTGGAAGCG
ACAAGCGTGGTGGTGCCAACGGCGCCCGTATTCGCTTGGCGCCCCAGAAGGACTGGGAGGTCAACAACCCCAAGCAGCTCGCCGAGGTTCTCAAGGCCCTCGAGGGTGTGCAGCAGAAGT
TCAACGGTTCGGGCAAGAAGATCTCTTTGGCTGATCTCATTGTCCTCGCCGGTGCTGCTGGTGTCGAGCAGGCAGCCAAGAATGCGGGCGTCGACATTAACGTGCCCTTCACCCCTGGTC
GTGGCGATGCTACCCAGGAGCAGACCGACGTTGAGTCTGTTGACCACCTTCAGCCCTACGCCGATGGATTCCGCAACTACGGCAAGTCCAGCAACCGTGCGAAGACCGAGCACTACCTTG
TCGACAAGGCACACCTACTAACGCTCACCGCTCCTGAGCTCACCGTTCTCGTTGGTGGCCTGCGTGTGCTGAACACCAACTTTGATGGCTCGTCAACTGGTGTATTCACCAACCGCCCCG
GCGCCTTGACCAATGACTTCTTCGTCAACTTGCTCGACATGGGCAACGAGTGGAAGGCCACCAACAATCAAGATGTCTACGAGGGCTTCGATCGCAAGTCAGGCTCCAAGAAGTACACTG
CCAGCCGTGTCGACCTTGTCTTTGGCTCTCACGCTGAGCTCCGCGCTGTTGCGGAGATCTACGCCCAGGCTGATGCCGGCCAGAAGTTCGTCAAGGACTTCGTGACCGTTTGGGACAAGG
TCATGAACCTGGACCGCTTTGATCTTAAGAAGCAGTCCGGTAGTGTGCCGAGCCGCCTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGGAAAAGTGTCCCTTCATTCGGACCATGAACACCGGAGGTGGCGGCACAAAGAACCGCGACTGGTGGCCCGATTCCCTTAAGCTCAACATCCTCCGCCAGCACACTCCCGTC
ACCAACCCGTTAGGTGGTGACTTTGACTACGTGTCTGCCTTCAAGACCCTCGACTACGATGGCGTCAAGAAGGACCTCACGGCTCTGATGACCGACTCTCAAGATTGGTGGCCTGCCGAT
TTTGGCCATTACGGAGGTCTCTTCATTCGTATGGCATGGCACAGCGCCGGTACCTACCGTGTTCATGACGGCCGTGGCGGCGGCGGTGAG
GGTCAGCAACGTTTTGCCCCTCTCAATAGT
TGGCCTGACAATGTCAGTCTCGACAAGGCCCGTCGCTTGTTATGGCCCATAAAGCAAAAGTACGGCAACAAGATCTCCTGGGCCGATCTTATGATCTTGGCTGGCAACGTTGCCCTCGAG
TCAATGGGCTTCCAGACTGCTGGTTTCTCTGGCGGACGTCCCGACACCTGGGAGGCTGATGAGTCCGTTTACTGGGGCGGCGAGACCACATGGCTTGGCAACGACGTCCGCTACTCCCAC
GGTCACGAAGGGAAGGCCGAGCCGGGCGTCCTCGACGGCTCTCAGGACACCAAGAGCAAGTCAGACATTCACACCCGCGACCTGGAGTCACCACTTGGTGCCGCCCATATGGGTCTCATT
TATGTGAACCCTGAGGGTCCCGACGGCAACCCCGACCCAGTCGCCGCTGCTAGAGACATTCGCGTCACTTTCGGACGCATGGCTATGAATGACGAGGAGACGGTGGCTCTCATCGCTGGT
GGTCACACTTTCGGCAAGACCCACGGTGCTGCTCCCGACAGCAACGTTGGTGCCGAGCCCGAGGCCTCTGGTCTCGAGGCTCAGGGCTTTGGCTGGGCCAACAAGCACGGTACCGGCAAG
GGCGCGGATACCATCACCAGTGGTCTGGAGGTTACTTGGACTGCTACTCCCACCAAGTGGAGCAACAAGTACTTCGAGTACCTATTCAAATTTGACTGGGAGCTCACCAAGAGTCCCGCT
GGTGCTAACCAGTGGGTGGCAAAGAACGCCGAGCCCATCATCCCCCATGCCTTCGACTCCAGCAAGAAGCAGCTTCCCACCATGTTGACGACCGACTTGTCGCTGCGCTTCGACCCCGAA
TATGAGAAGATCTCGAGACGCTTCCTCGAAAACCCGGATCAGTTCGCCGATGCATTCGCCAAGGCCTGGTTCAAGCTCACCCACCGTGACATGGGCCCGCGCTCCCGCTACGTTGGACCC
GAGGTTCCCTCTGAGGATTTCATCTGGCAGGACCCCATCCCTGCTCCCAGCTCGCCCCTCGTCAGCGAGCAGGACGTTGCTGCCCTCAAGAAGGAGGTTCTCGCCACTGGCATTGATGCC
TCCAAGCTCATCTCCACTGCTTGGGCTTCAGCCTCTACCTTCCGTGGAAGCGACAAGCGTGGTGGTGCCAACGGCGCCCGTATTCGCTTGGCGCCCCAGAAGGACTGGGAGGTCAACAAC
CCCAAGCAGCTCGCCGAGGTTCTCAAGGCCCTCGAGGGTGTGCAGCAGAAGTTCAACGGTTCGGGCAAGAAGATCTCTTTGGCTGATCTCATTGTCCTCGCCGGTGCTGCTGGTGTCGAG
CAGGCAGCCAAGAATGCGGGCGTCGACATTAACGTGCCCTTCACCCCTGGTCGTGGCGATGCTACCCAGGAGCAGACCGACGTTGAGTCTGTTGACCACCTTCAGCCCTACGCCGATGGA
TTCCGCAACTACGGCAAGTCCAGCAACCGTGCGAAGACCGAGCACTACCTTGTCGACAAGGCACACCTACTAACGCTCACCGCTCCTGAGCTCACCGTTCTCGTTGGTGGCCTGCGTGTG
CTGAACACCAACTTTGATGGCTCGTCAACTGGTGTATTCACCAACCGCCCCGGCGCCTTGACCAATGACTTCTTCGTCAACTTGCTCGACATGGGCAACGAGTGGAAGGCCACCAACAAT
CAAGATGTCTACGAGGGCTTCGATCGCAAGTCAGGCTCCAAGAAGTACACTGCCAGCCGTGTCGACCTTGTCTTTGGCTCTCACGCTGAGCTCCGCGCTGTTGCGGAGATCTACGCCCAG
GCTGATGCCGGCCAGAAGTTCGTCAAGGACTTCGTGACCGTTTGGGACAAGGTCATGAACCTGGACCGCTTTGATCTTAAGAAGCAGTCCGGTAGTGTGCCGAGCCGCCTTTAG

Retrieve as FASTA