Entry information : CfioCIIAA02_MH18
Entry ID 11815
Creation 2013-04-29 (Christophe Dunand)
Last sequence changes 2013-04-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-20 (Christophe Dunand)
Peroxidase information: CfioCIIAA02_MH18
Name CfioCIIAA02_MH18
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioCIIAA02_MH18
start..stop
S start..stop
CfioCIIAA02_PJ7 868 0 1..422 1..422
CgraCIIAA02 705 0 1..422 1..421
CgloCIIAA02_Naragc5 699 0 1..422 1..423
CgloCIIAA02_ST23 697 0 1..422 1..423
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 269274..269896 623 N° 2 269953..270598 646  
join(269274..269896,269953..270598)


exon

Literature and cross-references CfioCIIAA02_MH18
DNA ref. JGI genome:   scaffold_6 (269274..270598)
Cluster/Prediction ref. JGI gene:   1306824 [Incorrect prediction]
Protein sequence: CfioCIIAA02_MH18
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   423
PWM (Da):   %s   45469.88  
PI (pH):   %s   6.26
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRVSTFLTTALAATPIIAYPGMKNTFAEIRSRADVDGNGADDGDSNELIGDLITLDDSKLTPVGGSVKKLLTGFDNPESDDAYPTVGRSGTLAPKGSAACAADTCCIWKYIANDLQGTFRGRSGRCTDFARAAVRLGFHDAGGWSKGTGNLGGADGSIILASEEMARGENHGLEEIVAQTQVWFDRYKQFGIGMADLIQFSATVATVVCPLGPRIRTYVGRKDSSVPAPLNLLPPVTGSADFLIELFENKTIKPHGLTALIGAHTTSQQRFVDPSRAGDPQDSTPGVWDVKFYKETLGSAPARVFKFASDVVLSKDSRISSEFQAFAGQGGQSHWNQDYAREYIRLSLLGVFNINDLTECTKALPPRTGSTFTAPDQAVLDKWLATKDRLNNIADQLRNGGDINGMIASVMSWLKGVFHFRW*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Incorrect prediction from JGI (5'end is partial).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGTGTCAACTTTCCTTACTACCGCGCTCGCGGCCACGCCCATCATCGCCTACCCCGGCATGAAGAACACATTCGCCGAGATCCGCTCCCGCGCCGATGTAGACGGCAACGGCGCT
GACGACGGAGACTCTAACGAGCTCATTGGCGATCTCATCACCCTCGACGACTCCAAGCTCACTCCTGTTGGAGGCAGCGTCAAGAAGCTCCTTACCGGTTTTGATAACCCCGAGAGTGAC
GACGCCTACCCAACCGTCGGAAGATCAGGCACCCTCGCACCAAAGGGTTCAGCGGCTTGCGCTGCTGATACCTGCTGCATCTGGAAGTACATCGCCAACGATCTTCAGGGTACCTTCAGA
GGCAGATCCGGCCGTTGCACCGACTTCGCCCGCGCTGCCGTCCGTCTTGGCTTCCACGATGCCGGCGGCTGGTCAAAGGGAACCGGAAACCTCGGCGGAGCTGACGGCTCCATCATTCTC
GCTTCAGAAGAAATGGCACGCGGGGAGAACCACGGTCTCGAGGAGATTGTTGCCCAGACCCAGGTCTGGTTCGACCGGTATAAGCAGTTTGGAATCGGAATGGCCGATCTCATCCAGTTC
TCTGCAACTGTAGCCACTGTCGT
GTAAGTCATCCGGACCTATGGTCTCACAACCTGAGCGTGAACTGATTTCGTGACAGCTGCCCCTTGGGTCCTCGCATTCGCACATACGTCGGCCGCA
AGGACTCCTCTGTCCCTGCTCCCCTTAACCTTCTGCCTCCCGTCACCGGCTCTGCCGACTTCTTGATCGAGCTCTTTGAGAACAAGACCATCAAGCCCCACGGCCTCACCGCACTCATCG
GCGCCCACACGACCAGCCAGCAGCGCTTCGTGGACCCCAGCCGCGCCGGCGACCCGCAGGACAGCACCCCCGGTGTCTGGGACGTCAAGTTCTACAAGGAGACCCTCGGCTCCGCTCCTG
CTCGTGTCTTCAAATTTGCCAGCGATGTCGTCCTTTCTAAGGACTCCCGCATCAGCTCCGAGTTCCAGGCGTTCGCTGGCCAGGGCGGACAGTCCCACTGGAACCAGGACTACGCTCGCG
AGTATATCCGTCTCTCTCTTCTTGGTGTCTTCAACATCAACGACTTGACAGAGTGCACCAAGGCCCTGCCTCCTCGTACCGGAAGCACCTTCACCGCTCCCGACCAGGCTGTTTTGGACA
AATGGCTCGCCACCAAGGACCGCCTTAACAACATCGCCGATCAACTCAGGAACGGTGGCGACATCAATGGCATGATTGCGTCGGTTATGAGCTGGTTGAAGGGAGTCTTCCACTTCAGGT
GGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGTGTCAACTTTCCTTACTACCGCGCTCGCGGCCACGCCCATCATCGCCTACCCCGGCATGAAGAACACATTCGCCGAGATCCGCTCCCGCGCCGATGTAGACGGCAACGGCGCT
GACGACGGAGACTCTAACGAGCTCATTGGCGATCTCATCACCCTCGACGACTCCAAGCTCACTCCTGTTGGAGGCAGCGTCAAGAAGCTCCTTACCGGTTTTGATAACCCCGAGAGTGAC
GACGCCTACCCAACCGTCGGAAGATCAGGCACCCTCGCACCAAAGGGTTCAGCGGCTTGCGCTGCTGATACCTGCTGCATCTGGAAGTACATCGCCAACGATCTTCAGGGTACCTTCAGA
GGCAGATCCGGCCGTTGCACCGACTTCGCCCGCGCTGCCGTCCGTCTTGGCTTCCACGATGCCGGCGGCTGGTCAAAGGGAACCGGAAACCTCGGCGGAGCTGACGGCTCCATCATTCTC
GCTTCAGAAGAAATGGCACGCGGGGAGAACCACGGTCTCGAGGAGATTGTTGCCCAGACCCAGGTCTGGTTCGACCGGTATAAGCAGTTTGGAATCGGAATGGCCGATCTCATCCAGTTC
TCTGCAACTGTAGCCACTGTCGT
CTGCCCCTTGGGTCCTCGCATTCGCACATACGTCGGCCGCAAGGACTCCTCTGTCCCTGCTCCCCTTAACCTTCTGCCTCCCGTCACCGGCTCTGCC
GACTTCTTGATCGAGCTCTTTGAGAACAAGACCATCAAGCCCCACGGCCTCACCGCACTCATCGGCGCCCACACGACCAGCCAGCAGCGCTTCGTGGACCCCAGCCGCGCCGGCGACCCG
CAGGACAGCACCCCCGGTGTCTGGGACGTCAAGTTCTACAAGGAGACCCTCGGCTCCGCTCCTGCTCGTGTCTTCAAATTTGCCAGCGATGTCGTCCTTTCTAAGGACTCCCGCATCAGC
TCCGAGTTCCAGGCGTTCGCTGGCCAGGGCGGACAGTCCCACTGGAACCAGGACTACGCTCGCGAGTATATCCGTCTCTCTCTTCTTGGTGTCTTCAACATCAACGACTTGACAGAGTGC
ACCAAGGCCCTGCCTCCTCGTACCGGAAGCACCTTCACCGCTCCCGACCAGGCTGTTTTGGACAAATGGCTCGCCACCAAGGACCGCCTTAACAACATCGCCGATCAACTCAGGAACGGT
GGCGACATCAATGGCATGATTGCGTCGGTTATGAGCTGGTTGAAGGGAGTCTTCCACTTCAGGTGGTAA

Retrieve as FASTA