Entry information : CfioCIIAA03_MH18
Entry ID 11819
Creation 2013-04-29 (Christophe Dunand)
Last sequence changes 2013-04-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-20 (Christophe Dunand)
Peroxidase information: CfioCIIAA03_MH18
Name CfioCIIAA03_MH18
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioCIIAA03_MH18
start..stop
S start..stop
CfioCIIAA03_PJ7 830 0 1..403 1..403
ChigCIIAA03 697 0 1..403 1..403
CgraCIIAA03 683 0 1..403 1..403
CgloCIIAA01_Naragc5 553 0 1..402 1..401
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 266902..267900 999 N° 2 267977..268189 213  
join(266902..267900,267977..268189)


exon

Literature and cross-references CfioCIIAA03_MH18
DNA ref. JGI genome:   scaffold_4 (266902..268189)
Cluster/Prediction ref. JGI gene:   593148
Protein sequence: CfioCIIAA03_MH18
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   404 (386)
PWM (Da):   %s   43502.7 (41762.7)  
PI (pH):   %s   5.97 (5.56) Peptide Signal:   %s   cut: 18 range:18-403
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTTSLITAALAGVVVARPGMDINKMMADAKLEARQADGGGPSTELIGDLATLRGRELTATGQAIKDILTAEAPGQDLKSFYDDSDLPPKNSAECREDDCCIWKYIADDMAAQMVGNAGRCNNVARGAIRLGFHDAASWSKSTGGTGADGSIILANECKTRSDNKGLEEICDIMERWFAKYKKYKISMADLIQTASNVATVSCPLGPRVRTFVGRKDSTTPAVKKLLPDPSDSSAKLFKLFADKSFTPAGLVALMGAHSTSQQRFVDPSRADSPQDSTPGTWDIAYYQQTLNPNAPPAVFKFQSDINVSQDPRTNGVWKAFAAGPRGQFMWNEAYATEYVRMSLLGVNNINDLTECTKALPPFRPGFQQPDEDLLTKVMGSVINSDAIKQALEKGDKIPPNAI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCACATCCCTCATCACTGCAGCCTTAGCCGGCGTTGTGGTTGCTCGTCCTGGTATGGATATCAATAAGATGATGGCCGATGCCAAGCTCGAGGCTCGCCAAGCGGACGGTGGC
GGCCCTTCGACAGAGCTCATTGGCGATCTTGCCACGCTCCGAGGCCGCGAACTCACTGCGACCGGTCAGGCAATCAAGGATATCTTGACTGCCGAGGCTCCAGGCCAGGACCTGAAGAGT
TTTTACGATGACTCCGATCTTCCGCCAAAGAACTCGGCGGAGTGCAGAGAAGACGATTGCTGCATCTGGAAGTACATTGCCGACGATATGGCCGCACAGATGGTGGGCAATGCCGGCCGT
TGCAACAATGTCGCTCGTGGTGCTATTCGCCTGGGTTTCCACGACGCGGCGTCTTGGTCCAAATCTACCGGCGGCACTGGCGCCGATGGCTCCATCATCCTTGCCAACGAGTGCAAGACG
CGTTCCGACAATAAAGGTCTGGAGGAGATCTGCGATATCATGGAGCGCTGGTTTGCCAAGTACAAAAAGTACAAGATCTCCATGGCCGATTTGATCCAGACTGCCTCCAACGTTGCCACC
GTCTCCTGTCCCCTGGGACCCCGAGTCCGCACCTTTGTTGGTCGCAAAGACTCAACGACGCCCGCGGTGAAGAAGCTCTTGCCGGATCCATCCGACAGCTCAGCCAAGCTGTTCAAGCTC
TTTGCAGACAAATCCTTCACGCCAGCGGGCCTCGTCGCCCTGATGGGCGCGCACAGCACCAGCCAGCAACGCTTCGTTGATCCCTCGCGGGCCGACTCGCCCCAAGACAGTACGCCAGGA
ACTTGGGATATCGCCTACTACCAGCAGACGCTCAACCCCAATGCCCCCCCTGCTGTCTTCAAGTTCCAGAGCGACATCAACGTTTCCCAGGATCCGCGCACCAATGGGGTCTGGAAGGCA
TTCGCAGCGGGGCCGCGCGGTCAGTTCATGTGGAACGAG
GTAAGACTTTACCTGACGGCGTCACACGTTCGTCCCAACTTAATAGACTTCCCGAGGCTAACAACCTAAACCTTAGGCGTA
TGCGACAGAATACGTTCGCATGTCTCTGCTCGGCGTTAACAATATCAACGACTTGACCGAATGCACCAAGGCCCTGCCGCCTTTCCGCCCGGGCTTCCAGCAGCCTGATGAAGACCTGTT
GACTAAGGTCATGGGAAGCGTCATCAACTCTGACGCCATTAAGCAGGCCCTCGAAAAGGGTGACAAGATTCCTCCCAATGCCATATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCACATCCCTCATCACTGCAGCCTTAGCCGGCGTTGTGGTTGCTCGTCCTGGTATGGATATCAATAAGATGATGGCCGATGCCAAGCTCGAGGCTCGCCAAGCGGACGGTGGC
GGCCCTTCGACAGAGCTCATTGGCGATCTTGCCACGCTCCGAGGCCGCGAACTCACTGCGACCGGTCAGGCAATCAAGGATATCTTGACTGCCGAGGCTCCAGGCCAGGACCTGAAGAGT
TTTTACGATGACTCCGATCTTCCGCCAAAGAACTCGGCGGAGTGCAGAGAAGACGATTGCTGCATCTGGAAGTACATTGCCGACGATATGGCCGCACAGATGGTGGGCAATGCCGGCCGT
TGCAACAATGTCGCTCGTGGTGCTATTCGCCTGGGTTTCCACGACGCGGCGTCTTGGTCCAAATCTACCGGCGGCACTGGCGCCGATGGCTCCATCATCCTTGCCAACGAGTGCAAGACG
CGTTCCGACAATAAAGGTCTGGAGGAGATCTGCGATATCATGGAGCGCTGGTTTGCCAAGTACAAAAAGTACAAGATCTCCATGGCCGATTTGATCCAGACTGCCTCCAACGTTGCCACC
GTCTCCTGTCCCCTGGGACCCCGAGTCCGCACCTTTGTTGGTCGCAAAGACTCAACGACGCCCGCGGTGAAGAAGCTCTTGCCGGATCCATCCGACAGCTCAGCCAAGCTGTTCAAGCTC
TTTGCAGACAAATCCTTCACGCCAGCGGGCCTCGTCGCCCTGATGGGCGCGCACAGCACCAGCCAGCAACGCTTCGTTGATCCCTCGCGGGCCGACTCGCCCCAAGACAGTACGCCAGGA
ACTTGGGATATCGCCTACTACCAGCAGACGCTCAACCCCAATGCCCCCCCTGCTGTCTTCAAGTTCCAGAGCGACATCAACGTTTCCCAGGATCCGCGCACCAATGGGGTCTGGAAGGCA
TTCGCAGCGGGGCCGCGCGGTCAGTTCATGTGGAACGAG
GCGTATGCGACAGAATACGTTCGCATGTCTCTGCTCGGCGTTAACAATATCAACGACTTGACCGAATGCACCAAGGCCCTG
CCGCCTTTCCGCCCGGGCTTCCAGCAGCCTGATGAAGACCTGTTGACTAAGGTCATGGGAAGCGTCATCAACTCTGACGCCATTAAGCAGGCCCTCGAAAAGGGTGACAAGATTCCTCCC
AATGCCATATAG

Retrieve as FASTA