Entry information : CfioAPx-CcP02_MH18 (CfioHyBpox2)
Entry ID 11820
Creation 2013-04-29 (Christophe Dunand)
Last sequence changes 2013-04-29 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2016-12-30 (Marcel Zamocky)
Peroxidase information: CfioAPx-CcP02_MH18 (CfioHyBpox2)
Name (synonym) CfioAPx-CcP02_MH18 (CfioHyBpox2)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Glomerella
Organism Colletotrichum fioriniae (Glomerella acutata)    [TaxId: 710243 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CfioAPx-CcP02_MH18
start..stop
S start..stop
CfioAPx-CcP02_PJ7 1058 0 1..522 17..538
BdotAPx-CcP01 595 0 5..521 20..538
BparvAPx-CcP 520 0 6..480 21..497
MgrAPx-CcP1_70-15 486 2e-168 7..505 23..529
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11617..11713 97 N° 2 11770..13244 1475  
join(11617..11713,11770..13244)


exon

Literature and cross-references CfioAPx-CcP02_MH18 (CfioHyBpox2)
DNA ref. JGI genome:   scaffold_187 (11617..13244)
Cluster/Prediction ref. JGI gene:   1333308
Protein sequence: CfioAPx-CcP02_MH18 (CfioHyBpox2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   524
PWM (Da):   %s   56473.6  
PI (pH):   %s   4.46
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQSNGYVWPSRYDFLEDLLAIQSGATIFGFSSIVASCGNGQNNVGRQNSAEWIRAAFHDVVTYDKGAGTGGLDASLMYELDRDENLGRAFNRTFADMASFVNPRASAADLLALSVVAAAAGCGGQKIPFRAGRIDAIMAGPPGVPKPEQSLESHRTTFHRAGFNDSDMIALVACGHTLGRVHGDENQHVTGGEASDTNVVSFDNTPAAFDTAVVLGYLENDGVNPLVFNHNDTLNSDKRIFGVDGNVTMHAIADKETFQTTCAGVFEQMINTVPDHVTLSDPLELIDVKPYIDTLELSNDGTAIIFKGRIRVRTTNRDPEGFDIALDISQHNGQRTLIQTSRDRFQGGISIGFFGESFFWFRFDAQLDPTGGISGFNVQSMDLSTGQVETFDNSGTGGFPITDGLLYATDRSCLDITPRADGNMTLSVTAMVREDLLLVGGDVYLELTHRVHQQNIMLPRLQIESIPMTMGSAHIGGFVEFTETIPLAASGWNTVFDIVLVTRDGELRSDFHSSGTLASTSCS

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAATCAAATGGATATGTCTGGCCTTCGCGATATGACTTCCTGGAAGACCTTCTCGCAATTCAATCTGGGGCCACTATTTTTGGCTTCAGCAGCAGTACGAATCGACCCCATATTAAA
ATTTCGCTTGTTCTTTTTGCTGACGGATATTAGTTGTCGCCTCTTGTGGTAACGGGCAAAACAATGTCGGTCGTCAGAACTCTGCTGAATGGATCCGAGCCGCGTTCCACGATGTTGTTA
CCTATGACAAGGGAGCCGGCACTGGTGGTCTCGATGCGTCTCTCATGTACGAGCTAGACCGTGACGAGAACCTTGGAAGGGCCTTTAATCGCACGTTTGCCGACATGGCTAGCTTTGTCA
ACCCGAGGGCTAGCGCCGCCGATCTGCTCGCGCTTAGTGTGGTGGCCGCCGCAGCTGGGTGTGGTGGGCAGAAAATCCCTTTCCGAGCCGGCCGCATTGACGCGATCATGGCTGGGCCTC
CTGGCGTTCCGAAGCCCGAACAGTCTTTGGAAAGTCACAGGACGACGTTTCACCGAGCCGGATTCAACGACAGCGATATGATAGCGCTCGTAGCCTGTGGTCACACACTCGGCCGAGTTC
ATGGAGACGAAAATCAACACGTGACGGGCGGTGAGGCGTCCGATACGAACGTGGTCAGCTTTGACAACACTCCTGCCGCCTTCGACACCGCCGTGGTCCTTGGGTATCTCGAGAACGACG
GCGTCAATCCCTTGGTGTTTAATCATAACGACACCCTGAACTCGGACAAGAGGATCTTCGGCGTTGACGGCAACGTCACTATGCATGCTATAGCAGACAAGGAAACGTTCCAAACCACCT
GTGCAGGCGTATTCGAGCAAATGATCAACACGGTTCCTGATCACGTCACCCTGAGCGACCCGCTAGAGCTAATCGACGTTAAACCGTACATAGACACTTTAGAACTCAGCAATGATGGCA
CAGCGATCATCTTCAAAGGGCGAATCCGCGTGCGTACAACAAATCGCGACCCGGAGGGATTCGATATTGCTCTTGACATCTCTCAACACAACGGACAACGAACACTCATCCAAACCTCCA
GAGATCGTTTCCAGGGTGGGATATCGATTGGTTTCTTTGGAGAGTCTTTCTTCTGGTTTCGATTTGATGCCCAATTGGATCCAACTGGTGGAATTTCGGGCTTCAACGTACAGTCAATGG
ACCTCTCCACCGGCCAAGTCGAGACTTTTGACAATAGCGGGACAGGTGGCTTCCCGATCACTGATGGTTTGCTTTATGCAACAGATCGATCTTGCTTGGATATCACGCCAAGAGCCGATG
GTAATATGACGTTAAGTGTGACAGCTATGGTTCGAGAGGATCTGCTATTGGTTGGCGGCGATGTCTATCTCGAGCTCACACACCGAGTTCATCAGCAGAACATAATGTTACCCAGGCTTC
AAATCGAGAGCATACCGATGACTATGGGCAGCGCACATATTGGAGGTTTTGTGGAATTCACTGAAACGATCCCTCTGGCGGCAAGCGGATGGAATACAGTCTTTGACATTGTGCTAGTGA
CGAGGGATGGGGAGCTGAGGTCTGATTTTCATAGCTCAGGCACATTGGCAAGTACATCGTGCTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAATCAAATGGATATGTCTGGCCTTCGCGATATGACTTCCTGGAAGACCTTCTCGCAATTCAATCTGGGGCCACTATTTTTGGCTTCAGCAGCATTGTCGCCTCTTGTGGTAACGGG
CAAAACAATGTCGGTCGTCAGAACTCTGCTGAATGGATCCGAGCCGCGTTCCACGATGTTGTTACCTATGACAAGGGAGCCGGCACTGGTGGTCTCGATGCGTCTCTCATGTACGAGCTA
GACCGTGACGAGAACCTTGGAAGGGCCTTTAATCGCACGTTTGCCGACATGGCTAGCTTTGTCAACCCGAGGGCTAGCGCCGCCGATCTGCTCGCGCTTAGTGTGGTGGCCGCCGCAGCT
GGGTGTGGTGGGCAGAAAATCCCTTTCCGAGCCGGCCGCATTGACGCGATCATGGCTGGGCCTCCTGGCGTTCCGAAGCCCGAACAGTCTTTGGAAAGTCACAGGACGACGTTTCACCGA
GCCGGATTCAACGACAGCGATATGATAGCGCTCGTAGCCTGTGGTCACACACTCGGCCGAGTTCATGGAGACGAAAATCAACACGTGACGGGCGGTGAGGCGTCCGATACGAACGTGGTC
AGCTTTGACAACACTCCTGCCGCCTTCGACACCGCCGTGGTCCTTGGGTATCTCGAGAACGACGGCGTCAATCCCTTGGTGTTTAATCATAACGACACCCTGAACTCGGACAAGAGGATC
TTCGGCGTTGACGGCAACGTCACTATGCATGCTATAGCAGACAAGGAAACGTTCCAAACCACCTGTGCAGGCGTATTCGAGCAAATGATCAACACGGTTCCTGATCACGTCACCCTGAGC
GACCCGCTAGAGCTAATCGACGTTAAACCGTACATAGACACTTTAGAACTCAGCAATGATGGCACAGCGATCATCTTCAAAGGGCGAATCCGCGTGCGTACAACAAATCGCGACCCGGAG
GGATTCGATATTGCTCTTGACATCTCTCAACACAACGGACAACGAACACTCATCCAAACCTCCAGAGATCGTTTCCAGGGTGGGATATCGATTGGTTTCTTTGGAGAGTCTTTCTTCTGG
TTTCGATTTGATGCCCAATTGGATCCAACTGGTGGAATTTCGGGCTTCAACGTACAGTCAATGGACCTCTCCACCGGCCAAGTCGAGACTTTTGACAATAGCGGGACAGGTGGCTTCCCG
ATCACTGATGGTTTGCTTTATGCAACAGATCGATCTTGCTTGGATATCACGCCAAGAGCCGATGGTAATATGACGTTAAGTGTGACAGCTATGGTTCGAGAGGATCTGCTATTGGTTGGC
GGCGATGTCTATCTCGAGCTCACACACCGAGTTCATCAGCAGAACATAATGTTACCCAGGCTTCAAATCGAGAGCATACCGATGACTATGGGCAGCGCACATATTGGAGGTTTTGTGGAA
TTCACTGAAACGATCCCTCTGGCGGCAAGCGGATGGAATACAGTCTTTGACATTGTGCTAGTGACGAGGGATGGGGAGCTGAGGTCTGATTTTCATAGCTCAGGCACATTGGCAAGTACA
TCGTGCTCTTGA

Retrieve as FASTA