Entry information : AresCcP02
Entry ID 11848
Creation 2013-05-22 (Christophe Dunand)
Last sequence changes 2013-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-06-24 (Catherine Mathe (Scipio))
Peroxidase information: AresCcP02
Name AresCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Amorphothecaceae Amorphotheca
Organism Amorphotheca resinae    [TaxId: 5101 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AresCcP02
start..stop
S start..stop
OmaiCcP02 625 0 1..370 1..367
MbicCcP02 618 0 1..367 1..372
AmacrCcP01 605 0 1..366 1..367
MvarCcP01 595 0 1..367 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2009308..2009824 517 N° 2 2009876..2010249 374 N° 3 2010302..2010523 222  
join(2009308..2009824,2009876..2010249,2010302..2010523)


exon

Literature and cross-references AresCcP02
DNA ref. JGI genome:   scaffold_1 (2009308..2010523)
Cluster/Prediction ref. JGI gene:   32350
Protein sequence: AresCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   371
PWM (Da):   %s   41380.44  
PI (pH):   %s   8.67
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTARTFARAAFKSSPSTSAFKTSTRNTAFALPRQTLRQQARRAYSSEAPKSSSSTGIYLGVGALALGAGYYFYSQSSGSSASETKVFTPTFEDYQKVYNEIAERLEEKHDYDDGSYGPVLLRLAWHASGTYDKETGTGGSNGATMRFAPESDHGANAGLVAARDFLEPVKQKFPWITYSDLWILGGVCAVQEMHGPIIPYRPGRTDKDMSACTPDGRLPDASQGNKHLRDIFYRMGFNDQEIVALSGAHALGRCHSNRSGFEGPWTFSPTILTNEFFKLLVNEKWNWKKWNGPKYEDKTTKTLMMLPTDMALVTDKSFRQWVDKYAKDEELFFKDFAAVILKLFELGVPFAEGTEQSRWTFKPTHHS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTACCGCCCGCACCTTCGCCCGCGCGGCTTTCAAGTCGTCGCCCTCCACTTCTGCCTTCAAGACCTCTACCCGTAACACGGCCTTTGCCTTGCCGCGCCAGACCCTCCGCCAG
CAGGCCCGCCGTGCCTACTCCTCTGAAGCCCCCAAGTCCTCCTCCTCTACTGGCATCTACCTCGGTGTGGGAGCTCTCGCTCTCGGGGCCGGATACTACTTCTACTCCCAGAGCAGCGGC
TCGTCCGCCAGCGAGACCAAGGTCTTCACCCCCACGTTCGAGGACTACCAGAAGGTGTACAACGAGATCGCTGAGCGATTGGAGGAGAAGCACGACTACGATGATGGATCGTACGGCCCC
GTCCTGCTGCGATTGGCGTGGCACGCCAGCGGCACCTACGATAAGGAGACTGGAACTGGTGGTAGCAATGGCGCCACCATGAGATTTGCCCCCGAGAGTGACCACGGTGCCAATGCCGGT
CTGGTTGCCGCGAGAGACTTCCTAGAGCCCGTTAAGC
GTATGTTGGACCTACCTCGACCGAGTGAAGACACGCGCTAATAACTTGCAGAAAAGTTCCCTTGGATCACCTACTCCGACCTT
TGGATTCTCGGTGGTGTCTGCGCCGTCCAGGAGATGCACGGCCCCATCATCCCATACCGACCTGGTCGAACTGACAAGGATATGTCTGCTTGCACACCTGATGGACGTCTCCCAGATGCA
TCCCAAGGAAACAAGCACTTGCGCGACATCTTCTACCGTATGGGCTTCAACGACCAGGAGATCGTTGCCCTGAGCGGTGCTCACGCCCTCGGACGATGCCACAGTAACCGAAGTGGCTTC
GAGGGCCCATGGACATTCTCGCCCACTATCCTGACCAACGAGTTCTTCAAGCTCCTCGTGAACGAGAAGTGGAACTGGAAGAAGTGGAACGGTCCCAAGCAG
GTAGGTGTCCTTTCCTCC
GCGTACCGGGAGACGATGACTGACACCCCAATAGTATGAGGACAAGACCACCAAGACCCTGATGATGCTTCCCACCGACATGGCCCTTGTCACTGACAAGAGCTTCCGACAATGGGTCGA
CAAGTATGCCAAGGATGAGGAGCTCTTCTTCAAGGACTTCGCCGCCGTGATCCTCAAGCTCTTCGAGCTTGGTGTTCCCTTCGCCGAGGGCACCGAGCAGAGCCGATGGACCTTCAAGCC
CACCCACCACTCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTACCGCCCGCACCTTCGCCCGCGCGGCTTTCAAGTCGTCGCCCTCCACTTCTGCCTTCAAGACCTCTACCCGTAACACGGCCTTTGCCTTGCCGCGCCAGACCCTCCGCCAG
CAGGCCCGCCGTGCCTACTCCTCTGAAGCCCCCAAGTCCTCCTCCTCTACTGGCATCTACCTCGGTGTGGGAGCTCTCGCTCTCGGGGCCGGATACTACTTCTACTCCCAGAGCAGCGGC
TCGTCCGCCAGCGAGACCAAGGTCTTCACCCCCACGTTCGAGGACTACCAGAAGGTGTACAACGAGATCGCTGAGCGATTGGAGGAGAAGCACGACTACGATGATGGATCGTACGGCCCC
GTCCTGCTGCGATTGGCGTGGCACGCCAGCGGCACCTACGATAAGGAGACTGGAACTGGTGGTAGCAATGGCGCCACCATGAGATTTGCCCCCGAGAGTGACCACGGTGCCAATGCCGGT
CTGGTTGCCGCGAGAGACTTCCTAGAGCCCGTTAAGC
AAAAGTTCCCTTGGATCACCTACTCCGACCTTTGGATTCTCGGTGGTGTCTGCGCCGTCCAGGAGATGCACGGCCCCATCATC
CCATACCGACCTGGTCGAACTGACAAGGATATGTCTGCTTGCACACCTGATGGACGTCTCCCAGATGCATCCCAAGGAAACAAGCACTTGCGCGACATCTTCTACCGTATGGGCTTCAAC
GACCAGGAGATCGTTGCCCTGAGCGGTGCTCACGCCCTCGGACGATGCCACAGTAACCGAAGTGGCTTCGAGGGCCCATGGACATTCTCGCCCACTATCCTGACCAACGAGTTCTTCAAG
CTCCTCGTGAACGAGAAGTGGAACTGGAAGAAGTGGAACGGTCCCAAGCAG
TATGAGGACAAGACCACCAAGACCCTGATGATGCTTCCCACCGACATGGCCCTTGTCACTGACAAGAGC
TTCCGACAATGGGTCGACAAGTATGCCAAGGATGAGGAGCTCTTCTTCAAGGACTTCGCCGCCGTGATCCTCAAGCTCTTCGAGCTTGGTGTTCCCTTCGCCGAGGGCACCGAGCAGAGC
CGATGGACCTTCAAGCCCACCCACCACTCCTAG

Retrieve as FASTA