Entry information : AresAPx-CcP01
Entry ID 11850
Creation 2013-05-22 (Christophe Dunand)
Last sequence changes 2013-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-06-24 (Catherine Mathe (Scipio))
Peroxidase information: AresAPx-CcP01
Name AresAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Amorphothecaceae Amorphotheca
Organism Amorphotheca resinae    [TaxId: 5101 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AresAPx-CcP01
start..stop
S start..stop
MbicAPx-CcP01 1083 0 10..936 6..942
MvarAPx-CcP01 851 0 9..679 5..666
MvarAPx-CcP01 260 2e-73 695..937 740..999
MvarAPx-CcP01 223 8e-61 581..793 745..998
MvarAPx-CcP01 142 6e-35 567..677 894..999
MvarAPx-CcP01 138 1e-33 838..937 565..664
GsteAPx-CcP01 788 0 9..934 6..892
GsteAPx-CcP01 235 6e-65 580..934 646..996
TmiAPx-CcP_UCR-PA7 748 0 27..938 23..927
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 648481..649629 1149 N° 2 649687..649875 189 N° 3 649930..650331 402 N° 4 650407..650566 160
N° 5 650616..650786 171 N° 6 650922..651667 746  
join(648481..649629,649687..649875,649930..650331,650407..650566,650616..650786, 650922..651667)


exon

Literature and cross-references AresAPx-CcP01
DNA ref. JGI genome:   scaffold_9 (648481..651667)
Cluster/Prediction ref. JGI gene:   124747
Protein sequence: AresAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   939 (914)
PWM (Da):   %s   97620.68 (94942.3)  
PI (pH):   %s   3.99 (3.98) Peptide Signal:   %s   cut: 25 range:25-938
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPPYSTILTVLTWIAVFSSDGAAQPTWPSSIDELEDVMFLGSGYRSRGFHSFVTPCSASPDGPGRQTAAEWLRAGFHDMATTDIYYANKGIVHGGIDASLAFELNDGEDIGAGFNSTLLVYANFFNSRLPVADLIALGVYASVRACSGPVIPMRGGRIDATAAGPLGVPQPQNGIGQFTNQFARMGFNVTDMIAMTACGHTLGGVHAEDFTNIVAPGTAPNDFQLFDDTLEFDNNIATRYINGPDTDALSIGISTASGRNSDFQVFSADNNATLQAMTVPAVFNSMCISILQRMIETVPPTVTLSAVIEPYEVKPAGLQLTLLSGGTQLTFSGDIRVRTTVRSAAQISSVQLLYTDRNGASVSTPIDTVVAGTASGFDDSFSFYSFSVDLPVTTSISSFTVLITGTDGTTETYDNNGGGFPISDSVIVQTPQSCVNNGDLTVVAAVRSSVTTPVNMTVTEKVPRKAGSPTPSPVPSLVSTTLDMVQGDTIGPYNIYSASYSIASVAGTKYGVASGSFSDTFKDASDLGTTCGSLNVSEPSSTSSSIVSTSSTSVSSSPIVSTSSTPVSSSPIVPISSTPTIGAYSFQGCYTEADSTRALTGASFFNYTGMTLEQCATECVGFSYWGVEYGGECYCGNSLNTGSVLATNQGDCSFVCPGNSYEYCGAGNRLEMYLLSSLASSPSSISSTGTTQTLHIVPSAGLYNYYGCYTEGDGDRALGAAFYPSDTNTIEDCVAACSPYLYAGAEYGRECWCGNSFGAGSAPAPDSDCSMVCTGNQYEYCGAGNRLSVYIMNGTFAGGSAGSIPASSSQISSIPSSPGSSSTATSATAAATQTGATIKPSIGKYAYYGCQTEATNIRALNEASYYNYTSMTLEMCASDCGGYAYWGVEYGGECYCGNSLNAGSTNATESDCSFLCPGDDLEYCGAGNRLSTYYLTE

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). Peroxidase domain fused to 3 WSC domains (putative carbohydrate binding domain)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCCCCCTACTCTACGATCCTCACGGTCCTCACATGGATTGCGGTCTTTTCGAGCGATGGGGCAGCTCAACCGACATGGCCGTCTTCAATTGACGAGCTGGAAGATGTTATGTTT
CTTGGGTCGGGTTACAGAAGTAGAGGCTTTCACTCATTTGTAACGCCATGTTCTGCCTCCCCCGATGGGCCTGGGCGTCAAACTGCCGCCGAATGGCTTCGAGCGGGGTTCCATGATATG
GCAACGACAGACATTTACTATGCGAACAAAGGCATTGTGCATGGAGGAATCGACGCGTCTCTGGCTTTCGAACTGAACGATGGGGAAGACATTGGCGCAGGATTTAACAGCACCTTGCTC
GTATACGCCAACTTCTTCAACTCTCGATTACCTGTGGCTGATTTGATTGCTTTGGGAGTCTACGCATCTGTACGTGCATGCAGCGGGCCTGTTATACCCATGCGAGGTGGAAGGATAGAC
GCCACCGCTGCAGGCCCGTTGGGAGTTCCACAGCCACAGAATGGAATAGGGCAGTTTACGAACCAGTTCGCCAGGATGGGTTTTAATGTGACCGATATGATAGCGATGACGGCTTGCGGA
CATACACTCGGCGGAGTTCATGCTGAAGATTTCACCAACATTGTGGCACCGGGAACCGCACCGAACGATTTCCAACTTTTCGATGACACATTAGAGTTTGATAATAATATTGCTACACGA
TACATCAATGGTCCTGATACCGATGCATTGTCTATTGGCATATCAACTGCTTCAGGAAGGAACTCTGATTTTCAGGTGTTCAGCGCTGACAATAATGCCACATTGCAAGCAATGACCGTT
CCAGCAGTATTCAACAGCATGTGCATATCTATTCTGCAGAGAATGATTGAGACAGTACCACCAACTGTTACGCTTTCAGCTGTGATTGAACCATATGAGGTCAAGCCAGCTGGATTGCAA
CTTACATTGCTTTCAGGAGGTACCCAGCTTACTTTTTCGGGTGACATCCGAGTTAGGACCACTGTTCGCAGTGCTGCACAAATTTCCAGTGTGCAACTTTTGTACACGGACCGCAATGGT
GCCAGTGTCTCAACTCCAATTGATACTGTAGTGGCAGGGACGGCCAGTGGATTCGACGATAGCTTCTCA
GTATGTTCTTCAACGTTCTTCTCATCAGCCCTTGCGCCCTTGCTAATATTT
CCCCAGTTCTATTCCTTTAGCGTGGATCTTCCTGTAACCACCTCGATTTCCTCTTTTACGGTGCTTATCACCGGCACCGATGGTACAACTGAGACATACGACAATAATGGTGGTGGTTTT
CCCATCTCCGATTCGGTCATTGTTCAAACTCCCCAAAGCTGTGTGAACAATGGTGATTTGACTGTGGTGGCTGCT
GTGGGTTTCCTTGCCGCTCAGAGGGTTTAGCTGCATTTACTTACT
CTTGTATAGGTCCGAAGTAGTGTTACAACTCCAGTAAACATGACCGTTACCGAGAAAGTTCCTAGGAAGGCCGGATCGCCCACGCCGTCTCCTGTGCCTTCCCTGGTCTCTACAACCTTG
GATATGGTACAAGGAGATACCATTGGCCCTTATAACATCTACAGTGCTAGTTACTCCATTGCCTCTGTTGCAGGAACCAAGTATGGTGTTGCAAGTGGCTCATTTTCCGACACATTCAAA
GACGCTTCAGATCTTGGAACTACCTGCGGATCCCTTAATGTCAGTGAACCTAGCAGCACCTCCAGCTCCATTGTTTCAACCAGCAGCACATCTGTTTCTTCCAGCCCCATTGTTTCAACT
AGCAGCACACCTGTCTCTTCCAGCCCCATTGTTCCAATCAGTAGCACACCT
GTCTCCTCCAGCTCCTTATCAGTGACTAGTATCTCGACGTCGGCCATAGCAAGTCCAACACTTGGGATT
AAGCAGACAATTGGAGCCTACTCCTTTCAGGGATGTTACACAGAAGCAGATAGCACACGTGCCCTCACTGGAGCCTCGTTCTTCAACTACACCGGAATGACACTTGAACAATGCGCGACC
GAGTGCGTTGGGTTTTCGTACTGGGGTGTTGAGTATGGCGGAGAAT
GTTTGTCATCTATGATCCCCTTAACATTATGTTTACTGACCAAATGCAGGCTATTGCGGCAACTCCCTAAACAC
AGGGTCTGTTTTGGCAACTAACCAAGGAGACTGCAGCTTCGTATGCCCAGGAAACAGTTATGAATACTGTGGAGCTGGGAACAGGCTTGAGATGTACCTGCTCTCATCTCTTGCTTCGAG
TCCCAGCAGCATTTCGTCAACCGGGA
GTAGTATATCGAGTATGTTGAGCGATTCAAGCATTGTTTCTACAAGCTCCAGCAGCAGCACCCCACCCACCAGTTTAACGTCTAGCCCAGTTAC
TAGCCCATCAACCTCGGTACTGACCTCATCCAGTGCGGCAGCTACTCAGACACTCCACATAGTCCCGTCGGCTGGTCTCTACAACTATTATGGTTGCTACACCGAAGGCGACGGGGATCG
GGCCTTAGGTGCTGCATTTTACCCGAGCGACACCAACACAATCGAAGATTGCGTTGCCGCCTGCTCGCCTTACTTGTACGCTGGTGCTGAGTATGGACGAGAATGTTGGTGTGGTAACTC
TTTCGGAGCTGGCTCCGCTCCAGCTCCAGATTCCGACTGCTCCATGGTCTGTACTGGCAACCAGTATGAGTATTGTGGAGCTGGGAATCGGTTGAGTGTGTACATAATGAATGGCACCTT
TGCAGGAGGCTCTGCCGGCTCGATACCAGCATCCTCGTCTCAGATATCTTCAATACCAAGCTCGCCCGGAAGTAGCAGTACTGCGACTTCTGCTACTGCAGCGGCCACCCAAACCGGGGC
CACAATCAAGCCAAGTATCGGGAAGTACGCGTATTACGGATGCCAAACCGAGGCCACAAATATCCGGGCGTTGAACGAAGCATCATACTACAATTACACCTCCATGACGCTCGAGATGTG
CGCATCGGACTGTGGTGGGTATGCCTACTGGGGAGTGGAATATGGGGGCGAATGCTACTGCGGGAACAGTCTTAATGCCGGAAGTACGAATGCAACGGAGTCGGATTGCTCGTTCTTGTG
TCCAGGGGATGATTTGGAGTATTGCGGGGCGGGGAACAGGCTGAGTACTTATTATTTAACGGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCCCCCTACTCTACGATCCTCACGGTCCTCACATGGATTGCGGTCTTTTCGAGCGATGGGGCAGCTCAACCGACATGGCCGTCTTCAATTGACGAGCTGGAAGATGTTATGTTT
CTTGGGTCGGGTTACAGAAGTAGAGGCTTTCACTCATTTGTAACGCCATGTTCTGCCTCCCCCGATGGGCCTGGGCGTCAAACTGCCGCCGAATGGCTTCGAGCGGGGTTCCATGATATG
GCAACGACAGACATTTACTATGCGAACAAAGGCATTGTGCATGGAGGAATCGACGCGTCTCTGGCTTTCGAACTGAACGATGGGGAAGACATTGGCGCAGGATTTAACAGCACCTTGCTC
GTATACGCCAACTTCTTCAACTCTCGATTACCTGTGGCTGATTTGATTGCTTTGGGAGTCTACGCATCTGTACGTGCATGCAGCGGGCCTGTTATACCCATGCGAGGTGGAAGGATAGAC
GCCACCGCTGCAGGCCCGTTGGGAGTTCCACAGCCACAGAATGGAATAGGGCAGTTTACGAACCAGTTCGCCAGGATGGGTTTTAATGTGACCGATATGATAGCGATGACGGCTTGCGGA
CATACACTCGGCGGAGTTCATGCTGAAGATTTCACCAACATTGTGGCACCGGGAACCGCACCGAACGATTTCCAACTTTTCGATGACACATTAGAGTTTGATAATAATATTGCTACACGA
TACATCAATGGTCCTGATACCGATGCATTGTCTATTGGCATATCAACTGCTTCAGGAAGGAACTCTGATTTTCAGGTGTTCAGCGCTGACAATAATGCCACATTGCAAGCAATGACCGTT
CCAGCAGTATTCAACAGCATGTGCATATCTATTCTGCAGAGAATGATTGAGACAGTACCACCAACTGTTACGCTTTCAGCTGTGATTGAACCATATGAGGTCAAGCCAGCTGGATTGCAA
CTTACATTGCTTTCAGGAGGTACCCAGCTTACTTTTTCGGGTGACATCCGAGTTAGGACCACTGTTCGCAGTGCTGCACAAATTTCCAGTGTGCAACTTTTGTACACGGACCGCAATGGT
GCCAGTGTCTCAACTCCAATTGATACTGTAGTGGCAGGGACGGCCAGTGGATTCGACGATAGCTTCTCA
TTCTATTCCTTTAGCGTGGATCTTCCTGTAACCACCTCGATTTCCTCTTTT
ACGGTGCTTATCACCGGCACCGATGGTACAACTGAGACATACGACAATAATGGTGGTGGTTTTCCCATCTCCGATTCGGTCATTGTTCAAACTCCCCAAAGCTGTGTGAACAATGGTGAT
TTGACTGTGGTGGCTGCT
GTCCGAAGTAGTGTTACAACTCCAGTAAACATGACCGTTACCGAGAAAGTTCCTAGGAAGGCCGGATCGCCCACGCCGTCTCCTGTGCCTTCCCTGGTCTCT
ACAACCTTGGATATGGTACAAGGAGATACCATTGGCCCTTATAACATCTACAGTGCTAGTTACTCCATTGCCTCTGTTGCAGGAACCAAGTATGGTGTTGCAAGTGGCTCATTTTCCGAC
ACATTCAAAGACGCTTCAGATCTTGGAACTACCTGCGGATCCCTTAATGTCAGTGAACCTAGCAGCACCTCCAGCTCCATTGTTTCAACCAGCAGCACATCTGTTTCTTCCAGCCCCATT
GTTTCAACTAGCAGCACACCTGTCTCTTCCAGCCCCATTGTTCCAATCAGTAGCACACCT
ACAATTGGAGCCTACTCCTTTCAGGGATGTTACACAGAAGCAGATAGCACACGTGCCCTC
ACTGGAGCCTCGTTCTTCAACTACACCGGAATGACACTTGAACAATGCGCGACCGAGTGCGTTGGGTTTTCGTACTGGGGTGTTGAGTATGGCGGAGAAT
GCTATTGCGGCAACTCCCTA
AACACAGGGTCTGTTTTGGCAACTAACCAAGGAGACTGCAGCTTCGTATGCCCAGGAAACAGTTATGAATACTGTGGAGCTGGGAACAGGCTTGAGATGTACCTGCTCTCATCTCTTGCT
TCGAGTCCCAGCAGCATTTCGTCAACCGGGA
CTACTCAGACACTCCACATAGTCCCGTCGGCTGGTCTCTACAACTATTATGGTTGCTACACCGAAGGCGACGGGGATCGGGCCTTAGGT
GCTGCATTTTACCCGAGCGACACCAACACAATCGAAGATTGCGTTGCCGCCTGCTCGCCTTACTTGTACGCTGGTGCTGAGTATGGACGAGAATGTTGGTGTGGTAACTCTTTCGGAGCT
GGCTCCGCTCCAGCTCCAGATTCCGACTGCTCCATGGTCTGTACTGGCAACCAGTATGAGTATTGTGGAGCTGGGAATCGGTTGAGTGTGTACATAATGAATGGCACCTTTGCAGGAGGC
TCTGCCGGCTCGATACCAGCATCCTCGTCTCAGATATCTTCAATACCAAGCTCGCCCGGAAGTAGCAGTACTGCGACTTCTGCTACTGCAGCGGCCACCCAAACCGGGGCCACAATCAAG
CCAAGTATCGGGAAGTACGCGTATTACGGATGCCAAACCGAGGCCACAAATATCCGGGCGTTGAACGAAGCATCATACTACAATTACACCTCCATGACGCTCGAGATGTGCGCATCGGAC
TGTGGTGGGTATGCCTACTGGGGAGTGGAATATGGGGGCGAATGCTACTGCGGGAACAGTCTTAATGCCGGAAGTACGAATGCAACGGAGTCGGATTGCTCGTTCTTGTGTCCAGGGGAT
GATTTGGAGTATTGCGGGGCGGGGAACAGGCTGAGTACTTATTATTTAACGGAGTAA

Retrieve as FASTA