Entry information : OmaiAPx-CcP01
Entry ID 11852
Creation 2013-05-22 (Christophe Dunand)
Last sequence changes 2013-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: OmaiAPx-CcP01
Name OmaiAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Myxotrichaceae Oidiodendron
Organism Oidiodendron maius    [TaxId: 78148 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OmaiAPx-CcP01
start..stop
S start..stop
AresAPx-CcP01 714 0 8..508 12..532
MbicAPx-CcP01 586 0 1..508 1..521
MvarAPx-CcP01 587 0 20..508 21..522
GsteAPx-CcP01 489 8e-163 8..508 9..531
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1573492..1574628 1137 N° 2 1573308..1573436 129 N° 3 1572726..1573193 468  
complement(join(1572726..1573193,1573308..1573436,1573492..1574628))


exon

Literature and cross-references OmaiAPx-CcP01
DNA ref. JGI genome:   scaffold_3 (1574628..1572726)
Cluster/Prediction ref. JGI gene:   157520
Protein sequence: OmaiAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   578 (558)
PWM (Da):   %s   63046.16 (60539.8)  
PI (pH):   %s   5.7 (5.19) Peptide Signal:   %s   cut: 20 range:20-577
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRFLWPSLTWIILTSRFWAAQPTWPSSIDELEDVMFLGSGYKSRGFSSFVTPCSYSEHGPGRQAAAEWVQTAFHDMATTDIFYETKGSVHGGIDASLAFELNSGENIGSGLYTSLVTYARFFNSRLSISDLVALGVYTGVRACGGPAIPMRGGRIDATLAGPMGVPQPQNGIGQFTNQFMRMGYSKDDMIAMTACGHTLGGVHSDSFDDIVVPGTVRSDYQLFDGTEEFDNQIATRYINGPDINPLSVGVSKRRKKNSDFQVFSSDNNVTLKAMMNPTTFDAMCISILQRMIETVHPSAMLSDIIEPYEIKPSGLQLTLLSAGASFEFSGDIRVRTTVRKASQIGSVQILYKDINGFTVRSPIETKQAGKARGFDDNFTFYSFRTDIPILTSISSFAVTVVSTSSGNQVYDNNGKWFPISDSVRSLITTPVKMTITQKIPRNEGYPTPSPVPSLVSTSVTMIQEGIMGPYTLYSGSSTISSTVGVKYDVISGRYSDSFKDAEDLGDTCEIPDRHPLISNSSSSFSYIYSSDTSTKSKYGSSPVDISVTTAQPEPRELKPQHIGLDKLFKPTMSTERT*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTTCTGTGGCCGAGCCTAACCTGGATCATCTTAACTTCACGCTTCTGGGCAGCTCAGCCAACTTGGCCATCTTCAATTGACGAGTTGGAGGATGTCATGTTCCTTGGATCTGGG
TATAAGAGTAGAGGATTCTCCTCCTTTGTGACGCCATGCTCCTACTCTGAACACGGCCCTGGACGCCAGGCTGCCGCAGAATGGGTCCAAACTGCATTCCACGACATGGCAACCACTGAT
ATCTTCTACGAAACTAAGGGCTCGGTGCATGGAGGAATTGATGCTTCTCTGGCTTTCGAGTTAAACAGTGGAGAAAATATTGGTTCTGGGTTGTATACTTCCCTGGTTACATATGCACGC
TTCTTCAACTCGCGATTGTCTATATCTGATCTTGTAGCACTGGGAGTTTATACTGGCGTACGAGCTTGTGGTGGCCCTGCTATCCCTATGCGAGGCGGAAGAATCGATGCTACTTTAGCT
GGACCGATGGGAGTTCCACAACCGCAAAATGGGATAGGACAGTTTACGAATCAATTCATGAGAATGGGTTACAGCAAGGATGACATGATAGCCATGACTGCTTGTGGCCATACTCTTGGA
GGCGTTCATTCTGACAGCTTCGACGATATTGTGGTTCCTGGAACAGTACGCAGTGATTACCAGCTATTCGATGGCACAGAGGAGTTCGATAATCAAATCGCTACTCGATATATCAATGGT
CCAGATATCAATCCACTCTCAGTTGGAGTATCGAAGAGAAGAAAGAAAAACTCCGACTTTCAGGTTTTCAGCTCAGACAATAATGTGACTCTGAAGGCCATGATGAACCCGACGACTTTC
GATGCCATGTGTATATCGATTTTGCAGAGAATGATCGAGACGGTACATCCAAGTGCTATGCTATCAGATATAATTGAGCCATATGAGATTAAGCCTTCTGGCTTGCAACTCACATTGCTC
TCCGCAGGAGCGAGTTTCGAGTTTTCTGGCGATATTCGAGTCAGAACAACGGTTCGGAAAGCCTCACAAATTGGTTCTGTGCAAATACTGTACAAAGACATAAATGGATTTACTGTGAGG
TCGCCAATTGAGACTAAGCAGGCAGGAAAAGCTCGAGGATTTGATGATAACTTTACT
GTATGTCTCTTATCGACCAGCTCAAACGCTAGATGCCTTGCTGACCGCTTTCAAGTTCTACTC
GTTCAGAACTGATATTCCTATACTAACATCAATTTCGTCATTCGCAGTGACTGTTGTTAGTACCAGTAGCGGAAACCAGGTATATGACAATAATGGAAAATGGTTTCCGATTTCTGATAG
T
GTAATTGTTCAAACACCTCGGAGCTGTGTTAGCAATGGTAGATTATATATATTGGCTGCTGCAAGTTGTGCACTAGAGAAGATACCAGTACCAAGTTTGCTTACTAGCATATAGGTCCG
AAGCCTTATCACAACTCCGGTCAAGATGACCATTACTCAAAAAATTCCTCGAAACGAAGGATATCCAACGCCGTCTCCTGTACCTTCCCTTGTCTCTACATCAGTGACCATGATACAAGA
AGGAATAATGGGTCCATATACTTTGTATAGCGGGAGTTCTACTATTTCTTCAACCGTTGGAGTCAAGTATGATGTTATAAGCGGCCGATATTCAGACTCGTTCAAAGATGCTGAGGACCT
TGGGGATACGTGCGAGATTCCGGACAGGCATCCTCTTATCAGCAACAGCAGCAGCAGTTTCAGTTATATCTACTCTTCGGATACTTCAACTAAGAGCAAATATGGGTCCTCACCGGTTGA
TATCTCTGTAACAACAGCTCAGCCCGAACCGAGGGAGTTAAAGCCTCAACATATTGGACTAGACAAACTCTTCAAGCCTACAATGTCTACGGAACGTACATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTTCTGTGGCCGAGCCTAACCTGGATCATCTTAACTTCACGCTTCTGGGCAGCTCAGCCAACTTGGCCATCTTCAATTGACGAGTTGGAGGATGTCATGTTCCTTGGATCTGGG
TATAAGAGTAGAGGATTCTCCTCCTTTGTGACGCCATGCTCCTACTCTGAACACGGCCCTGGACGCCAGGCTGCCGCAGAATGGGTCCAAACTGCATTCCACGACATGGCAACCACTGAT
ATCTTCTACGAAACTAAGGGCTCGGTGCATGGAGGAATTGATGCTTCTCTGGCTTTCGAGTTAAACAGTGGAGAAAATATTGGTTCTGGGTTGTATACTTCCCTGGTTACATATGCACGC
TTCTTCAACTCGCGATTGTCTATATCTGATCTTGTAGCACTGGGAGTTTATACTGGCGTACGAGCTTGTGGTGGCCCTGCTATCCCTATGCGAGGCGGAAGAATCGATGCTACTTTAGCT
GGACCGATGGGAGTTCCACAACCGCAAAATGGGATAGGACAGTTTACGAATCAATTCATGAGAATGGGTTACAGCAAGGATGACATGATAGCCATGACTGCTTGTGGCCATACTCTTGGA
GGCGTTCATTCTGACAGCTTCGACGATATTGTGGTTCCTGGAACAGTACGCAGTGATTACCAGCTATTCGATGGCACAGAGGAGTTCGATAATCAAATCGCTACTCGATATATCAATGGT
CCAGATATCAATCCACTCTCAGTTGGAGTATCGAAGAGAAGAAAGAAAAACTCCGACTTTCAGGTTTTCAGCTCAGACAATAATGTGACTCTGAAGGCCATGATGAACCCGACGACTTTC
GATGCCATGTGTATATCGATTTTGCAGAGAATGATCGAGACGGTACATCCAAGTGCTATGCTATCAGATATAATTGAGCCATATGAGATTAAGCCTTCTGGCTTGCAACTCACATTGCTC
TCCGCAGGAGCGAGTTTCGAGTTTTCTGGCGATATTCGAGTCAGAACAACGGTTCGGAAAGCCTCACAAATTGGTTCTGTGCAAATACTGTACAAAGACATAAATGGATTTACTGTGAGG
TCGCCAATTGAGACTAAGCAGGCAGGAAAAGCTCGAGGATTTGATGATAACTTTACT
TTCTACTCGTTCAGAACTGATATTCCTATACTAACATCAATTTCGTCATTCGCAGTGACTGTT
GTTAGTACCAGTAGCGGAAACCAGGTATATGACAATAATGGAAAATGGTTTCCGATTTCTGATAGT
GTCCGAAGCCTTATCACAACTCCGGTCAAGATGACCATTACTCAAAAAATTCCT
CGAAACGAAGGATATCCAACGCCGTCTCCTGTACCTTCCCTTGTCTCTACATCAGTGACCATGATACAAGAAGGAATAATGGGTCCATATACTTTGTATAGCGGGAGTTCTACTATTTCT
TCAACCGTTGGAGTCAAGTATGATGTTATAAGCGGCCGATATTCAGACTCGTTCAAAGATGCTGAGGACCTTGGGGATACGTGCGAGATTCCGGACAGGCATCCTCTTATCAGCAACAGC
AGCAGCAGTTTCAGTTATATCTACTCTTCGGATACTTCAACTAAGAGCAAATATGGGTCCTCACCGGTTGATATCTCTGTAACAACAGCTCAGCCCGAACCGAGGGAGTTAAAGCCTCAA
CATATTGGACTAGACAAACTCTTCAAGCCTACAATGTCTACGGAACGTACATGA

Retrieve as FASTA