Entry information : OmaiCcP01
Entry ID 11853
Creation 2013-05-22 (Christophe Dunand)
Last sequence changes 2013-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: OmaiCcP01
Name OmaiCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP002]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Myxotrichaceae Oidiodendron
Organism Oidiodendron maius    [TaxId: 78148 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OmaiCcP01
start..stop
S start..stop
AresCcP01 543 0 1..296 1..296
AmacrCcP02 534 0 1..296 1..295
SsclCcP01 530 0 1..296 1..296
BfuCcP01 528 0 1..296 1..296
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1804850..1804959 110 N° 2 1805016..1805811 796  
join(1804850..1804959,1805016..1805811)


exon

Literature and cross-references OmaiCcP01
DNA ref. JGI genome:   scaffold_1 (1804850..1805811)
Cluster/Prediction ref. JGI gene:   108415
Protein sequence: OmaiCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   302
PWM (Da):   %s   33285.57  
PI (pH):   %s   6.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKQGDFEAVRKDIAALLKQPGYDDGSAGPVFVRLAWHSAGTYDAETDTGGSNGAGMRYEAEGGDPANAGLQHARAFLESVKEKHPWITYADLWTLAGVVAIKEMGGPTIPWKGGRTDYVDDSKLPPRGRLPDAAQGADHIRWIFSRMGFNDQEIVALSGAHNLGRCHSDRSGFEGAWVNSPTRFSNQYFRLLLSLQWRKKILKNGIVQFMNYDEDTETELMMLPTDISLTTDPSFKKYVELYAKDKDRFFEDFSKVFDKLMELGIVRDASGAVTNADNVKGGYHSAPKKKNSPGAAMARL

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAAACAAGGGGACTTTGAAGCTGTCCGCAAGGACATTGCCGCTCTTCTTAAGCAGCCCGGATACGATGATGGGAGTGCAGGTCCTGTGTTTGTCCGGCTAGCATGGTACAAATAT
CATCTTGGTTGTCTTCTGTATAACACATACTAATGACCATCTCCAGGCACTCTGCCGGAACATATGACGCCGAGACCGACACTGGTGGATCGAATGGCGCTGGTATGCGTTATGAAGCGG
AAGGTGGGGACCCCGCCAATGCTGGCCTTCAACATGCCCGCGCCTTCCTCGAGTCCGTGAAGGAAAAGCATCCATGGATCACTTACGCTGACCTCTGGACTCTTGCCGGTGTCGTAGCTA
TCAAAGAGATGGGGGGTCCTACAATCCCCTGGAAGGGTGGCCGGACAGATTATGTCGACGATAGCAAGCTCCCACCACGAGGACGACTCCCGGATGCAGCCCAGGGCGCAGACCACATCC
GTTGGATCTTCAGCCGCATGGGCTTCAACGACCAGGAGATCGTCGCCCTCTCAGGAGCCCACAACCTTGGTCGCTGTCACTCCGACCGATCAGGATTTGAGGGCGCGTGGGTCAACAGCC
CAACTCGTTTCTCGAATCAGTACTTCCGACTTCTGCTCTCGCTGCAGTGGAGGAAGAAGATATTAAAGAACGGGATCGTGCAGTTTATGAACTATGATGAGGACACCGAGACTGAATTGA
TGATGTTGCCGACAGACATTTCGCTGACAACGGACCCGAGCTTCAAGAAGTACGTTGAGCTATATGCCAAGGACAAGGATCGGTTCTTTGAGGATTTCAGCAAAGTCTTCGACAAGTTGA
TGGAGCTGGGTATTGTTCGTGATGCGAGCGGAGCCGTCACGAATGCGGATAATGTGAAGGGCGGTTACCACTCTGCGCCAAAGAAGAAGAACAGCCCGGGCGCCGCCATGGCGAGGCTGT
GA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAAACAAGGGGACTTTGAAGCTGTCCGCAAGGACATTGCCGCTCTTCTTAAGCAGCCCGGATACGATGATGGGAGTGCAGGTCCTGTGTTTGTCCGGCTAGCATGGCACTCTGCC
GGAACATATGACGCCGAGACCGACACTGGTGGATCGAATGGCGCTGGTATGCGTTATGAAGCGGAAGGTGGGGACCCCGCCAATGCTGGCCTTCAACATGCCCGCGCCTTCCTCGAGTCC
GTGAAGGAAAAGCATCCATGGATCACTTACGCTGACCTCTGGACTCTTGCCGGTGTCGTAGCTATCAAAGAGATGGGGGGTCCTACAATCCCCTGGAAGGGTGGCCGGACAGATTATGTC
GACGATAGCAAGCTCCCACCACGAGGACGACTCCCGGATGCAGCCCAGGGCGCAGACCACATCCGTTGGATCTTCAGCCGCATGGGCTTCAACGACCAGGAGATCGTCGCCCTCTCAGGA
GCCCACAACCTTGGTCGCTGTCACTCCGACCGATCAGGATTTGAGGGCGCGTGGGTCAACAGCCCAACTCGTTTCTCGAATCAGTACTTCCGACTTCTGCTCTCGCTGCAGTGGAGGAAG
AAGATATTAAAGAACGGGATCGTGCAGTTTATGAACTATGATGAGGACACCGAGACTGAATTGATGATGTTGCCGACAGACATTTCGCTGACAACGGACCCGAGCTTCAAGAAGTACGTT
GAGCTATATGCCAAGGACAAGGATCGGTTCTTTGAGGATTTCAGCAAAGTCTTCGACAAGTTGATGGAGCTGGGTATTGTTCGTGATGCGAGCGGAGCCGTCACGAATGCGGATAATGTG
AAGGGCGGTTACCACTCTGCGCCAAAGAAGAAGAACAGCCCGGGCGCCGCCATGGCGAGGCTGTGA

Retrieve as FASTA