Entry information : OmaiCcP02
Entry ID 11854
Creation 2013-05-22 (Christophe Dunand)
Last sequence changes 2013-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: OmaiCcP02
Name OmaiCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Myxotrichaceae Oidiodendron
Organism Oidiodendron maius    [TaxId: 78148 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OmaiCcP02
start..stop
S start..stop
AresCcP02 598 0 1..367 1..370
MbicCcP02 589 0 1..362 1..370
AmacrCcP01 586 0 1..362 1..366
MvarCcP01 573 0 1..364 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1893027..1893537 511 N° 2 1893604..1893977 374 N° 3 1894056..1894274 219  
join(1893027..1893537,1893604..1893977,1894056..1894274)


exon

Literature and cross-references OmaiCcP02
DNA ref. JGI genome:   scaffold_4 (1893027..1894274)
Cluster/Prediction ref. JGI gene:   159019
Protein sequence: OmaiCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   368
PWM (Da):   %s   41066.52  
PI (pH):   %s   9.04
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTTRIFARAAFKAHPSTPVLKTTTRNTAFALPRHAFRQQSRRGYSSEAPKSSTSGLYLTLGVLALGGGAYYYYSQAPNAAEVKVFTPKFEDYQKVYDEIASRLEEKDDYDDGSYGPVLVRLAWHASGTYDKETGTGGSNGATMRFAPESDHGANAGLKAAREFLEPVKAKFPWISTSDLWILGGVVAIQEMQGPVIPFRPGRTDKDMSACTPDGRLPDASKGNRHLRDIFYRMGFNDQEIVALSGAHALGRCHTDRSGFEGPWTFSPTVVTNEYYKLLLNEKWNWKKWNGPKYEDKTSKSLMMLPTDMALVTDKTLKPHVERYAKDEEAWFKDFSAVLLKLFELGVPFTESEQNRMVFKSSHSS*

Retrieve as FASTA  
Remarks Complete sequenc efrom genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTACAACTCGCATCTTCGCCCGCGCGGCGTTCAAGGCCCACCCCTCGACGCCTGTCCTCAAGACCACAACCCGCAACACCGCCTTCGCCCTCCCCCGCCATGCCTTCCGCCAG
CAGTCCCGTCGTGGCTACTCCTCCGAGGCCCCCAAGTCCTCTACCTCGGGCCTGTATCTCACCCTGGGCGTCCTGGCCCTGGGTGGCGGGGCGTACTACTACTACTCCCAAGCCCCAAAC
GCCGCCGAGGTCAAGGTCTTCACGCCCAAGTTCGAGGACTACCAGAAGGTGTATGACGAGATCGCGTCGCGGCTGGAGGAGAAGGACGACTACGACGATGGATCCTACGGCCCCGTCCTG
GTGCGCCTGGCCTGGCACGCCAGCGGCACCTACGATAAGGAGACCGGCACCGGGGGCAGCAACGGTGCCACAATGAGATTCGCGCCCGAGAGTGACCATGGCGCCAATGCTGGGTTGAAG
GCCGCGAGGGAGTTTCTGGAGCCAGTTAAAG
GTGAGTCGACCCTCCCCCTCTCGTAATACCGGCACCAAACATCCAGCTGACCATTTGCCCTTCCAGCCAAGTTCCCCTGGATCTCGACC
TCCGACCTCTGGATCCTCGGGGGGGTCGTCGCCATCCAGGAGATGCAAGGTCCTGTTATCCCCTTCCGACCCGGCCGCACCGACAAGGACATGTCTGCGTGTACACCCGACGGCCGGCTG
CCGGATGCTAGCAAGGGCAACCGACATCTGCGAGATATCTTCTACCGCATGGGCTTCAATGACCAAGAGATCGTGGCTCTGAGCGGTGCTCATGCCCTGGGTCGCTGCCACACGGATCGC
AGTGGCTTCGAGGGGCCTTGGACCTTCTCGCCCACTGTCGTCACCAACGAGTACTACAAGCTGCTCCTGAATGAGAAATGGAACTGGAAGAAATGGAATGGTCCCAAGCAG
GTAGGTTTA
GCAACTTTGCTGTCTTTAACCCATTCAGCATTCGAAAACAAAGCTAGTAACTGATCATTTTGAAAATAGTATGAAGATAAGACCTCCAAATCTCTCATGATGCTTCCCACCGACATGGCT
CTCGTCACCGACAAGACCCTCAAGCCGCATGTTGAGCGATACGCCAAGGATGAGGAGGCCTGGTTCAAGGACTTCTCCGCCGTTCTGCTTAAGCTCTTCGAGCTCGGTGTTCCCTTCACC
GAGTCCGAGCAGAACAGAATGGTCTTCAAGTCCTCGCACTCCTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTACAACTCGCATCTTCGCCCGCGCGGCGTTCAAGGCCCACCCCTCGACGCCTGTCCTCAAGACCACAACCCGCAACACCGCCTTCGCCCTCCCCCGCCATGCCTTCCGCCAG
CAGTCCCGTCGTGGCTACTCCTCCGAGGCCCCCAAGTCCTCTACCTCGGGCCTGTATCTCACCCTGGGCGTCCTGGCCCTGGGTGGCGGGGCGTACTACTACTACTCCCAAGCCCCAAAC
GCCGCCGAGGTCAAGGTCTTCACGCCCAAGTTCGAGGACTACCAGAAGGTGTATGACGAGATCGCGTCGCGGCTGGAGGAGAAGGACGACTACGACGATGGATCCTACGGCCCCGTCCTG
GTGCGCCTGGCCTGGCACGCCAGCGGCACCTACGATAAGGAGACCGGCACCGGGGGCAGCAACGGTGCCACAATGAGATTCGCGCCCGAGAGTGACCATGGCGCCAATGCTGGGTTGAAG
GCCGCGAGGGAGTTTCTGGAGCCAGTTAAAG
CCAAGTTCCCCTGGATCTCGACCTCCGACCTCTGGATCCTCGGGGGGGTCGTCGCCATCCAGGAGATGCAAGGTCCTGTTATCCCCTTC
CGACCCGGCCGCACCGACAAGGACATGTCTGCGTGTACACCCGACGGCCGGCTGCCGGATGCTAGCAAGGGCAACCGACATCTGCGAGATATCTTCTACCGCATGGGCTTCAATGACCAA
GAGATCGTGGCTCTGAGCGGTGCTCATGCCCTGGGTCGCTGCCACACGGATCGCAGTGGCTTCGAGGGGCCTTGGACCTTCTCGCCCACTGTCGTCACCAACGAGTACTACAAGCTGCTC
CTGAATGAGAAATGGAACTGGAAGAAATGGAATGGTCCCAAGCAG
TATGAAGATAAGACCTCCAAATCTCTCATGATGCTTCCCACCGACATGGCTCTCGTCACCGACAAGACCCTCAAG
CCGCATGTTGAGCGATACGCCAAGGATGAGGAGGCCTGGTTCAAGGACTTCTCCGCCGTTCTGCTTAAGCTCTTCGAGCTCGGTGTTCCCTTCACCGAGTCCGAGCAGAACAGAATGGTC
TTCAAGTCCTCGCACTCCTCTTAA

Retrieve as FASTA