Entry information : OmaiAPx-CcP02
Entry ID 11855
Creation 2013-05-22 (Christophe Dunand)
Last sequence changes 2013-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: OmaiAPx-CcP02
Name OmaiAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Myxotrichaceae Oidiodendron
Organism Oidiodendron maius    [TaxId: 78148 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OmaiAPx-CcP02
start..stop
S start..stop
Ssrc1lsm3aAPx-CcP01 646 0 9..531 7..525
MEspAPx-CcP01_NRRL54901 622 0 12..531 3..516
ClunAPx-CcP01 616 0 20..531 20..529
AalteAPx-CcP01 612 0 8..531 6..525
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 94895..95285 391 N° 2 95392..95624 233 N° 3 95675..96076 402 N° 4 96129..96695 567
join(94895..95285,95392..95624,95675..96076,96129..96695)


exon

Literature and cross-references OmaiAPx-CcP02
DNA ref. JGI genome:   scaffold_4 (94895..96695)
Cluster/Prediction ref. JGI gene:   51297
Protein sequence: OmaiAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   532 (510)
PWM (Da):   %s   55936.71 (53583.4)  
PI (pH):   %s   5.05 (5.04) Peptide Signal:   %s   cut: 22 range:22-531
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRCILSLLLCVLLAAEPSVAAFYYPTAQVSLLDHILVDNWGAYASNFSSAITPCTNYVTEVGEPALISGRTTAAQWIRVAFHDYVTANVTAGTGGLDASIGFETLRSENSGSAMNDSFTFWRPFMNDAVSMSDLVAIGTVMSMSLCGGHKLPFRPGRVDAMAADPTTGVPAPETDLNTTLLYFARAGFDRSDAIGLTACGHTMGSVHGGFPDVVPVSAVTANNTNGGINFDTTRGVFDPLVVHEYIDWTGHMGGPLVTTDNVTTRSDLRLYESDSNSTMRALYAQGEGFLDTCVNLMGRMVNTVPSGVTLGDPIQPMLIKPINVTYDFSTDGNLTLSGRIRVLTSAGETAPSYLTLKAGSSNQQLTSEAETGTSVFGANIKSTASAYGTTTYFPFIIAGRQTAGAKSFTISWPGRKTATFPIQDDVFVVPSATEISGTVINATVAARSGINGGAYSIQIAAPTAQMGTLGPKVIRATLNMRRLPGMNDGYALWQGSVDLGKVPTGLVSVSVMREGATIDTFMVNPGAAGW

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTGCATTCTCAGCCTTCTATTATGTGTATTGTTGGCGGCTGAGCCTTCGGTGGCTGCCTTCTACTACCCCACAGCCCAAGTCTCGCTGCTGGACCACATCCTCGTTGACAACTGG
GGAGCCTACGCCTCCAACTTTTCGTCTGCAATAACACCATGCACCAACTATGTGACGGAAGTAGGTGAGCCAGCACTCATCAGTGGGCGAACCACGGCTGCGCAATGGATACGCGTCGCA
TTCCACGACTATGTGACCGCCAATGTCACGGCAGGAACGGGCGGCCTTGATGCCAGTATTGGCTTTGAGACGCTTCGTAGCGAGAACTCCGGCAGCGCGATGAATGATAGTTTTACGTTC
TGGCGCCCATTCATGAATGATGCAGTATCTA
GTGAGTTTTCTCTGGTTCCGCAATATTGGAAATGGAATCGCATGCCAGTTCCCAGATCGGCTTTCAGGGTTCGGCAGTGTCATGGCGAG
TTTACTAACTTTGGCAGTGTCTGATCTCGTTGCCATCGGAACGGTCATGTCCATGAGCCTCTGCGGGGGGCACAAACTTCCATTCCGGCCTGGGAGGGTCGACGCGATGGCGGCCGACCC
AACCACTGGCGTTCCCGCACCAGAAACAGACCTCAACACCACTCTGCTATACTTTGCAAGGGCTGGCTTTGACAGGTCAGATGCCATTGGCCTGACGGCGTGCGGTCATACAATGGGCTC
TGTCCATCAC
GTAGGTCCAACACCAAAATGAGGACAATAAGGGGCATTAATACCTCACAGGGCGGATTTCCAGACGTCGTGCCAGTATCGGCCGTGACCGCCAACAACACTAACGGTGGT
ATCAACTTTGACACCACGCGCGGCGTATTTGATCCCCTCGTGGTGCATGAGTATATCGACTGGACTGGGCATATGGGCGGTCCGCTTGTCACTACAGACAACGTGACCACTCGATCCGAT
CTCCGCCTCTATGAAAGCGACAGCAATTCCACCATGCGTGCTCTCTATGCGCAAGGGGAAGGATTCCTAGATACTTGTGTTAATTTAATGGGCCGTATGGTTAATACCGTGCCCTCGGGC
GTAACTTTGGGGGATCCCATCCAGCCAATGCTGATCAAGCCGATCAACGTAACCTATGACTTTAGTACCGATGGGAATCTGACGCTCTCGGGACGGATTAGG
GTGAATAGAATTTCAGGC
AAAGAAGATGTAACTGAGACTGACAATTCTGCAGGTCTTGACATCAGCCGGTGAAACTGCTCCATCATACTTAACGCTGAAGGCTGGTAGTTCTAATCAGCAGCTGACCTCCGAGGCTGA
GACTGGCACTTCAGTTTTTGGTGCTAACATTAAATCGACAGCCTCAGCGTATGGAACGACGACGTACTTCCCATTTATAATCGCAGGAAGACAAACGGCAGGAGCTAAATCATTTACCAT
CTCTTGGCCAGGGCGGAAGACTGCAACGTTCCCAATCCAGGACGACGTCTTCGTAGTTCCAAGCGCTACGGAAATATCGGGAACGGTGATAAACGCAACTGTTGCAGCTCGCTCTGGGAT
CAATGGTGGGGCTTACAGTATCCAGATTGCCGCACCGACTGCGCAGATGGGGACCTTAGGACCTAAGGTAATCCGAGCAACGCTGAACATGAGGAGGCTTCCCGGTATGAACGATGGATA
TGCGCTGTGGCAAGGGTCGGTGGACTTGGGTAAGGTGCCAACAGGACTGGTTAGCGTTAGCGTCATGAGAGAAGGGGCTACTATCGACACGTTTATGGTTAATCCTGGGGCTGCTGGGTG
G

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTGCATTCTCAGCCTTCTATTATGTGTATTGTTGGCGGCTGAGCCTTCGGTGGCTGCCTTCTACTACCCCACAGCCCAAGTCTCGCTGCTGGACCACATCCTCGTTGACAACTGG
GGAGCCTACGCCTCCAACTTTTCGTCTGCAATAACACCATGCACCAACTATGTGACGGAAGTAGGTGAGCCAGCACTCATCAGTGGGCGAACCACGGCTGCGCAATGGATACGCGTCGCA
TTCCACGACTATGTGACCGCCAATGTCACGGCAGGAACGGGCGGCCTTGATGCCAGTATTGGCTTTGAGACGCTTCGTAGCGAGAACTCCGGCAGCGCGATGAATGATAGTTTTACGTTC
TGGCGCCCATTCATGAATGATGCAGTATCTA
TGTCTGATCTCGTTGCCATCGGAACGGTCATGTCCATGAGCCTCTGCGGGGGGCACAAACTTCCATTCCGGCCTGGGAGGGTCGACGCG
ATGGCGGCCGACCCAACCACTGGCGTTCCCGCACCAGAAACAGACCTCAACACCACTCTGCTATACTTTGCAAGGGCTGGCTTTGACAGGTCAGATGCCATTGGCCTGACGGCGTGCGGT
CATACAATGGGCTCTGTCCATCAC
GGCGGATTTCCAGACGTCGTGCCAGTATCGGCCGTGACCGCCAACAACACTAACGGTGGTATCAACTTTGACACCACGCGCGGCGTATTTGATCCC
CTCGTGGTGCATGAGTATATCGACTGGACTGGGCATATGGGCGGTCCGCTTGTCACTACAGACAACGTGACCACTCGATCCGATCTCCGCCTCTATGAAAGCGACAGCAATTCCACCATG
CGTGCTCTCTATGCGCAAGGGGAAGGATTCCTAGATACTTGTGTTAATTTAATGGGCCGTATGGTTAATACCGTGCCCTCGGGCGTAACTTTGGGGGATCCCATCCAGCCAATGCTGATC
AAGCCGATCAACGTAACCTATGACTTTAGTACCGATGGGAATCTGACGCTCTCGGGACGGATTAGG
GTCTTGACATCAGCCGGTGAAACTGCTCCATCATACTTAACGCTGAAGGCTGGT
AGTTCTAATCAGCAGCTGACCTCCGAGGCTGAGACTGGCACTTCAGTTTTTGGTGCTAACATTAAATCGACAGCCTCAGCGTATGGAACGACGACGTACTTCCCATTTATAATCGCAGGA
AGACAAACGGCAGGAGCTAAATCATTTACCATCTCTTGGCCAGGGCGGAAGACTGCAACGTTCCCAATCCAGGACGACGTCTTCGTAGTTCCAAGCGCTACGGAAATATCGGGAACGGTG
ATAAACGCAACTGTTGCAGCTCGCTCTGGGATCAATGGTGGGGCTTACAGTATCCAGATTGCCGCACCGACTGCGCAGATGGGGACCTTAGGACCTAAGGTAATCCGAGCAACGCTGAAC
ATGAGGAGGCTTCCCGGTATGAACGATGGATATGCGCTGTGGCAAGGGTCGGTGGACTTGGGTAAGGTGCCAACAGGACTGGTTAGCGTTAGCGTCATGAGAGAAGGGGCTACTATCGAC
ACGTTTATGGTTAATCCTGGGGCTGCTGGGTGG

Retrieve as FASTA