Entry information : GmarCIIBC04
Entry ID 11874
Creation 2013-05-23 (Nizar Fawal)
Last sequence changes 2016-02-01 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2017-04-19 (Catherine Mathe (Scipio))
Peroxidase information: GmarCIIBC04
Name GmarCIIBC04
Class Other class II peroxidase type C    [Orthogroup: CIIBC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarCIIBC04
start..stop
S start..stop
GmarCIIBC01 582 0 1..355 1..357
GmarCIIBC02 571 0 1..355 1..352
GmarCIIBC 528 0 1..355 1..354
GmarCIIBC14 518 0 1..355 1..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 532471..532597 127 N° 2 532656..532779 124 N° 3 532890..532945 56 N° 4 532998..533010 13
N° 5 533063..533128 66 N° 6 533180..533396 217 N° 7 533456..533470 15 N° 8 533535..533575 41
N° 9 533638..533804 167 N° 10 533859..533953 95 N° 11 534010..534087 78 N° 12 534161..534229 69
join(532471..532597,532656..532779,532890..532945,532998..533010,533063..533128, 533180..533396,533456..533470,533535..533575,533638..533804,533859..533953,53401 0..534087,534161..534229)


exon

Literature and cross-references GmarCIIBC04
DNA ref. JGI genome:   scaffold_30 (532471..534229)
Cluster/Prediction ref. JGI gene:   103111
Protein sequence: GmarCIIBC04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (333)
PWM (Da):   %s   37372.13 (34933.7)  
PI (pH):   %s   4.99 (4.86) Peptide Signal:   %s   cut: 23 range:23-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFIRLNLIVSTALVVSQVVNAALVKRVTCSTGQVTANAACCALFPIVENLQKNLFDDADCGEEAHSALRIAFHDAIGFSLKGTGGGADGSILAFNQTETAFPANGGVDEIVDAQFPLFLESKLSAGDFVHLAAAVGTANCPGAPRLPFFLGRPPPKAAAPDLTVPEPTDSVTSILARFADAGFSPQEVVALLASHTIAAADSVDPTIPGTPFDTSPGFFDGNLFLEVLLRGRLFPGQGKQTGEVLSPIAGEMRLQSDFAISQDSRTACFWQDMINNQKHMMSEFAAAMTKLQVLGQDKRRLVDCSDVIPVPRVIEGTVRIPATFIRSDIQIACAAKTFPKLATRGGPAPTVAPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic ( 11 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCATTCGCCTTAACTTAATCGTCTCCACCGCTCTCGTGGTTTCACAGGTTGTCAATGCTGCTCTCGTCAAGCGCGTAACCTGTTCTACTGGCCAGGTGACGGCGAACGCAGCC
TGCTGTG
GTATGTGCATCCGTCCCTATAGTACCGTTCCAATGATTCACCTTTCTCTTTTCTTTAGCCCTTTTCCCCATTGTGGAAAATTTGCAAAAGAATCTTTTCGATGATGCTGACTG
CGGTGAAGAAGCTCATTCAGCTCTCCGAATCGCATTCCATGACGCCATTGGGTTCTCGCTTAAAGGTAC
GTTCGAAAGAGGATTTGTAAATTCATTTCTGATTCCAATGACGGTCTTCAG
GCGGAAAGTCCGTCACCTATTTATAGCTTTTCCTCAATGCTTGGCTAATTATCGTACAGGGGCGGAGGTGCCGATGGTTCTATTTTGGCCTTCAATCAGACCGAGACGGCTTTCCGTGTG
TTCAATTTTATGAACATGATATACCGATTTACTGATTGTGCCCGTAGCTGCTAACGGAGGGTAATCAACCGGCTCCGATCCTCTTACCTCATCTGATTTTTTAAATCTTTAGCGTCGACG
AGATAGTGGACGCTCAGTTCCCATTGTTCCTCGAGTCGAAGTTATCTGCTGGTGACTT
GTGCGTACTTTGGCTTAAAAGTTGGGTATCAATTTTCATTTTTCTTATTAGCGTCCACCTCG
CGGCAGCTGTTGGTACGGCTAACTGCCCAGGAGCGCCTAGGCTGCCATTTTTCCTCGGCCGTCCTCCACCCAAAGCCGCCGCACCTGATCTCACAGTTCCGGAACCCACCGACAGTGTGA
CCTCAATTCTTGCCAGATTTGCTGATGCCGGATTCTCTCCTCAGGAGGTCGTTGCCCTGCTCGCCTCACATACTATTGCAGCTGCT
GTACGTGCGGATCACGAACACGTCGATATGACCG
ATTACTGAATTTACCCTTCTTCTAGGATAGCGTTGACCCAGTAAATACACATCTCCCCCACACGATAGCCCTTTTTACCGCGTATCTAACAAAGTTTATTGCAGACTATTCCCGGAACCC
CCTTCGATACTAGCCCAGGCTTCTT
GTACGTTTAATGCTTTGTTTTTTTTTTGTTTGAACCATAACATAATTATGCTTCTCTAAAAGTGACGGTAATTTATTCCTTGAAGTCCTTTTGCG
AGGGCGCCTGTTCCCCGGTCAAGGGAAGCAGACAGGGGAAGTTCTCTCTCCGATAGCTGGAGAGATGCGTCTCCAGAGCGACTTTGCTATCTCCCAGGATTCACGAACTGCTTGTTTCTG
GCAAGACATGATTA
GTGAGTATCATTTCCTTCGTATAAACAATATTTGCTTACTGACCTTGTCAATAGACAACCAGAAGCATATGATGAGCGAATTTGCCGCAGCCATGACAAAACTGCA
GGTGTTGGGACAGGACAAAAGGAGGCTCGTGGACTGCTCTGAT
GTGCGTACATTTAATCTGCGTTTTACCCAGTGTTGAAACGCATTTCGTCGTTGCAGGTCATACCCGTCCCAAGAGTG
ATTGAGGGTACAGTTAGGATTCCCGCGACCTTCATCCGCTCTGATATTCAAATAGCT
GTACGTTTCGGTTGGTTTTATCGGATATTTTATTGCAAAACTGATTTTTCCCCTTGTTAATTT
TGCACCTTAGTGCGCTGCCAAGACATTCCCGAAGCTAGCGACACGCGGAGGACCCGCTCCGACTGTGGCTCCCGTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCATTCGCCTTAACTTAATCGTCTCCACCGCTCTCGTGGTTTCACAGGTTGTCAATGCTGCTCTCGTCAAGCGCGTAACCTGTTCTACTGGCCAGGTGACGGCGAACGCAGCC
TGCTGTG
CCCTTTTCCCCATTGTGGAAAATTTGCAAAAGAATCTTTTCGATGATGCTGACTGCGGTGAAGAAGCTCATTCAGCTCTCCGAATCGCATTCCATGACGCCATTGGGTTCTCG
CTTAAAGGTAC
GGGCGGAGGTGCCGATGGTTCTATTTTGGCCTTCAATCAGACCGAGACGGCTTTCCCTGCTAACGGAGGCGTCGACGAGATAGTGGACGCTCAGTTCCCATTGTTCCTC
GAGTCGAAGTTATCTGCTGGTGACTT
CGTCCACCTCGCGGCAGCTGTTGGTACGGCTAACTGCCCAGGAGCGCCTAGGCTGCCATTTTTCCTCGGCCGTCCTCCACCCAAAGCCGCCGCA
CCTGATCTCACAGTTCCGGAACCCACCGACAGTGTGACCTCAATTCTTGCCAGATTTGCTGATGCCGGATTCTCTCCTCAGGAGGTCGTTGCCCTGCTCGCCTCACATACTATTGCAGCT
GCT
GATAGCGTTGACCCAACTATTCCCGGAACCCCCTTCGATACTAGCCCAGGCTTCTTTGACGGTAATTTATTCCTTGAAGTCCTTTTGCGAGGGCGCCTGTTCCCCGGTCAAGGGAAG
CAGACAGGGGAAGTTCTCTCTCCGATAGCTGGAGAGATGCGTCTCCAGAGCGACTTTGCTATCTCCCAGGATTCACGAACTGCTTGTTTCTGGCAAGACATGATTA
ACAACCAGAAGCAT
ATGATGAGCGAATTTGCCGCAGCCATGACAAAACTGCAGGTGTTGGGACAGGACAAAAGGAGGCTCGTGGACTGCTCTGAT
GTCATACCCGTCCCAAGAGTGATTGAGGGTACAGTTAGG
ATTCCCGCGACCTTCATCCGCTCTGATATTCAAATAGCT
TGCGCTGCCAAGACATTCCCGAAGCTAGCGACACGCGGAGGACCCGCTCCGACTGTGGCTCCCGTGTGA

Retrieve as FASTA