Entry information : GmarCIIBC05
Entry ID 11875
Creation 2013-05-23 (Nizar Fawal)
Last sequence changes 2016-02-08 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2017-04-19 (Catherine Mathe (Scipio))
Peroxidase information: GmarCIIBC05
Name GmarCIIBC05
Class Other class II peroxidase type C    [Orthogroup: CIIBC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarCIIBC05
start..stop
S start..stop
GmarCIIBC06 546 0 1..352 1..354
HsubCIIBC04 519 0 1..355 1..357
GmarCIIBC14 518 0 1..355 1..357
GmarCIIBC12 517 0 1..352 1..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19623..19743 121 N° 2 19500..19564 65 N° 3 19398..19452 55 N° 4 19328..19332 5
N° 5 19220..19290 71 N° 6 19039..19104 66 N° 7 18865..18986 122 N° 8 18711..18805 95
N° 9 18642..18656 15 N° 10 18556..18581 26 N° 11 18488..18502 15 N° 12 18383..18433 51
N° 13 18246..18325 80 N° 14 18148..18183 36 N° 15 17997..18085 89 N° 16 17857..17934 78
N° 17 17725..17789 65 N° 18 17655..17667 13  
complement(join(17655..17667,17725..17789,17857..17934,17997..18085,18148..18183 ,18246..18325,18383..18433,18488..18502,18556..18581,18642..18656,18711..18805,1 8865..18986,19039..19104,19220..19290,19328..19332,19398..19452,19500..19564,196 23..19743))


exon

Literature and cross-references GmarCIIBC05
DNA ref. JGI genome:   scaffold_65 (19743..17655)
Cluster/Prediction ref. JGI gene:   106691
Protein sequence: GmarCIIBC05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (335)
PWM (Da):   %s   37003.29 (34867.1)  
PI (pH):   %s   4.14 (4.05) Peptide Signal:   %s   cut: 21 range:21-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFARLAVLVALAASHLTNAAIIKRFACSTGQTTTNEACCKLFPIVDQIQKDLFDGGECGEEAHSALRLAFHDAIGFSLQVRYSNRGGGADGSLLAFNTTETAFSTTDDIVASQFPVFLESGLSAGDFVHLAAAIGTGNCPGAPKLDFFFGRPDPVAPAPDRTVPEPTDSVTAILSRFADAGFSPSEVVALLASHTIAAADQIDPSIPGTPFDSTVGTFDSQVFLEVLLKGTLFPGNGPQSGEVESPIAGEMRLQSDFAISQDSRTACLWQNMIDNQNVMASAFKAAMSKLQVLGQSDLIDCSDVVPVPASFDGPIKYPASFSQSDVQIACAESPFPSLATVEGPAPTLAPVPGS*

Retrieve as FASTA  
Remarks complete sequence from genomics (17 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCGCTCGCCTTGCAGTCCTCGTCGCCCTTGCAGCCTCGCATTTGACCAACGCTGCTATCATTAAGCGCTTCGCCTGTTCCACTGGCCAAACGACGACCAACGAAGCTTGTTGT
A
GTGAGTGTACTATGTGTCTTGCATGAGGTGATCAGAGGTCTCAAGCAACTTCGTGTAGAACTATTCCCGATCGTCGACCAAATTCAAAAAGACCTGTTCGACGGCGGTGAATGCGGTGA
AGAG
GTTCGTTCCCAAAAAAAGAATATTATTCCCCACTTATCTTTCAAAAGGCTCACTCGGCACTTCGCCTTGCCTTCCACGACGCGATTGGTTTCTCTCTTCAAGGTCTGACAGCTTTC
TTTGGCTTATTTGAATTATGATATTTAACATCGAATGGTTTAGGCGGAAAGTTCGTGTCCTAGGCCGTACCTTGACGGACGACGCTGACCTAGTATTCTAATAGGGGCGGAGGCGCTGAC
GGTTCACTTCTTGCTTTCAATACAACAGAGACTGCATTCAGTAC
GTGTATTTGCCCTCGAATTTCGCAGTTTAATTCACCAGGTTTTCGTCTTACAGATGCTAACGGAGGGTAAATAGCT
TGGTGGTTGCACTTGTACTGTATTGAACTTCTATCACAGTACCGACGACATTGTTGCGAGCCAATTCCCAGTCTTCCTAGAATCTGGGTTAAGTGCTGGTGACTTGTAGGTCTCCCACCA
CTATTATTAAAGAGTCTTCTTAAAATCTCCTGCGCAGTGTACACCTCGCAGCAGCCATTGGTACTGGGAACTGCCCAGGTGCCCCAAAACTTGACTTCTTCTTTGGTCGTCCAGATCCAG
TTGCCCCTGCTCCTGATCGCACCGTACCGGAGCCGACTG
GTAAGCTTCACAATCAAGAGTTCCGCAGGAGGCATTGGGTTTGACCTTGACCATCCCAGACAGTGTCACCGCCATTCTTTC
TAGGTTCGCTGATGCAGGCTTTAGCCCATCTGAGGTAGTTGCTCTCCTCGCTTCGCACACCATTGCTGCCGCG
GTAAGTTTGGACGAACCCTGTAAATAGAAACTTCGACGCTTATTCCA
TTTTTAGGACCAAATTGATCCGGTGAATATCCTCTTTGCAACTTGAAAGTCATCATCTAATCGGGCTAAATTTTATACTCAGTCGATACCAGGGACTCCATTCGATTCGTAAGTCGATCC
ATCACAATTCCTAGCTGGGCCCTTTTGACGCTTCTCGGCAGTACTGTTGGCACCTTGTGCGTTCATCCGTTTTCTCGACCTACCTCGTTATAACTTGTTTCTGCTTCTAGCGATTCTCAG
GTCTTCCTCGAGGTGCTCCTGAAGGGAACGTTGTTCCCAGG
GTAAGTGAGCCCATCTCAAAGGAAACCCTATCCAACTTAGCTGTTAAACGACAACAGGAATGGACCTCAGTCTGGTGAA
GTAGAGTCTCCAATTGCTGGGGAGATGCGTCTTCAGAGTGATTTCGCAATTTCTCAAG
GTCTCTGTCTTCGTCTCTCTTCATTCCCACAAATATCTGAACTGAATTTGAAATTCACTCAG

ATTCAAGGACTGCCTGCCTCTGGCAAAATATGATCG
GTGGGTATACCTCGTGCTTGGAGCATCTCAGTACAAATTAATTATTGTGTTTTCCTAAACAGACAACCAAAATGTCATGGCGTC
TGCTTTTAAGGCAGCCATGTCGAAGCTGCAAGTCCTCGGCCAAAGCGATCTTATTGATTGTTCTGAT
GTACGTATTGTTTCGATGAGGGATATGTCAGTTATGGAGTGCTTATCTCGATC
CTTGTATAGGTGGTCCCTGTGCCTGCTTCGTTCGATGGTCCCATTAAATATCCAGCCAGTTTCTCTCAGAGCGATGTACAAATTGCGGTAAGTAGCGCTAAATATTTTCAACGGATTCTA
CCTATGCTTAAACTCTTGAATTTATTTAATATAGTGCGCTGAATCGCCATTCCCTAGTCTCGCGACTGTTGAGGGTCCCGCACCTACACTTGCCCCAGTGTTAGTTCTCTCTTTCCTGTG
TGGTGGACGTCATTTAACAAATCTTCTCTGAGCTAGTCCTGGATCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCGCTCGCCTTGCAGTCCTCGTCGCCCTTGCAGCCTCGCATTTGACCAACGCTGCTATCATTAAGCGCTTCGCCTGTTCCACTGGCCAAACGACGACCAACGAAGCTTGTTGT
A
AACTATTCCCGATCGTCGACCAAATTCAAAAAGACCTGTTCGACGGCGGTGAATGCGGTGAAGAGGCTCACTCGGCACTTCGCCTTGCCTTCCACGACGCGATTGGTTTCTCTCTTCAA
G
TTCGTTATTCTAATAGGGGCGGAGGCGCTGACGGTTCACTTCTTGCTTTCAATACAACAGAGACTGCATTCAGTACTACCGACGACATTGTTGCGAGCCAATTCCCAGTCTTCCTAGAA
TCTGGGTTAAGTGCTGGTGACTT
TGTACACCTCGCAGCAGCCATTGGTACTGGGAACTGCCCAGGTGCCCCAAAACTTGACTTCTTCTTTGGTCGTCCAGATCCAGTTGCCCCTGCTCCT
GATCGCACCGTACCGGAGCCGACTG
ACAGTGTCACCGCCATTCTTTCTAGGTTCGCTGATGCAGGCTTTAGCCCATCTGAGGTAGTTGCTCTCCTCGCTTCGCACACCATTGCTGCCGCG
GACCAAATTGATCCGTCGATACCAGGGACTCCATTCGATTCTACTGTTGGCACCTTCGATTCTCAGGTCTTCCTCGAGGTGCTCCTGAAGGGAACGTTGTTCCCAGGGAATGGACCTCAG
TCTGGTGAAGTAGAGTCTCCAATTGCTGGGGAGATGCGTCTTCAGAGTGATTTCGCAATTTCTCAAG
ATTCAAGGACTGCCTGCCTCTGGCAAAATATGATCGACAACCAAAATGTCATG
GCGTCTGCTTTTAAGGCAGCCATGTCGAAGCTGCAAGTCCTCGGCCAAAGCGATCTTATTGATTGTTCTGAT
GTGGTCCCTGTGCCTGCTTCGTTCGATGGTCCCATTAAATATCCAGCC
AGTTTCTCTCAGAGCGATGTACAAATTGCG
TGCGCTGAATCGCCATTCCCTAGTCTCGCGACTGTTGAGGGTCCCGCACCTACACTTGCCCCAGTTCCTGGATCCTAA

Retrieve as FASTA