Entry information : GmarCIIBC06
Entry ID 11876
Creation 2013-05-23 (Nizar Fawal)
Last sequence changes 2017-04-27 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-27 (Catherine Mathe)
Peroxidase information: GmarCIIBC06
Name GmarCIIBC06
Class Other class II peroxidase type C    [Orthogroup: CIIBC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarCIIBC06
start..stop
S start..stop
GmarCIIBC09 586 0 1..354 1..356
GmarCIIBC12 585 0 1..354 1..354
GmarCIIBC14 571 0 1..354 1..354
HsubCIIBC02 568 0 1..354 1..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 74302..74428 127 N° 2 74184..74248 65 N° 3 74074..74135 62 N° 4 73907..73962 56
N° 5 73836..73848 13 N° 6 73721..73786 66 N° 7 73546..73667 122 N° 8 73398..73492 95
N° 9 73327..73341 15 N° 10 73245..73270 26 N° 11 73169..73183 15 N° 12 73066..73116 51
N° 13 72932..73011 80 N° 14 72843..72878 36 N° 15 72701..72789 89 N° 16 72567..72644 78
N° 17 72442..72510 69  
complement(join(72442..72510,72567..72644,72701..72789,72843..72878,72932..73011 ,73066..73116,73169..73183,73245..73270,73327..73341,73398..73492,73546..73667,7 3721..73786,73836..73848,73907..73962,74074..74135,74184..74248,74302..74428))


exon

Literature and cross-references GmarCIIBC06
DNA ref. JGI genome:   scaffold_65 (74428..72442)
Cluster/Prediction ref. JGI gene:   106718
Protein sequence: GmarCIIBC06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354 (332)
PWM (Da):   %s   36865.64 (34561.4)  
PI (pH):   %s   5.07 (4.91) Peptide Signal:   %s   cut: 23 range:23-354
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFARLTALISIAFAASQVATAALTKRVTCSNGHVTANAACCNLFPIVDKIQADLFDGGECGEEAHSALRLAFHDAIGFSIHGQPGGGADGSILVFNATELKFHANGGIDDITARQFPVFQETGLTPGDFVHLAAAIGTGNCPGAPRLNFFFGRAPPRAPAPDLTVPEPTDSVTAILARFADAGFSPAEAVALLSSHTIAAADVVDPTIPGTPFDSTVGTFDSQVFLEVLLKGRLFPGNGSQTGEVLSPIAGEMRLQSDFAISQDARTACLWQNMINNQNLMTTQFKSAMSKLQVLGQPRLIDCSDVVPVPKPFAGPIKFPASFSQADVQIACKQSPFPSLATVAGPAPTVPPV*

Retrieve as FASTA  
Remarks complete sequence from genomics (16 introns). Error in JGI prediction : small exon is missing
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCGCTCGCTTGACCGCTCTCATCTCAATCGCGTTCGCTGCCTCTCAAGTAGCGACTGCTGCCCTCACCAAACGCGTTACATGTTCGAATGGTCATGTAACTGCTAATGCAGCA
TGTTGCA
GTCAGTACTCATCCTTTGCCTCAGTAAACTCTGGCCTCAATGCTTTGTTTTAGATCTCTTCCCAATCGTCGACAAAATTCAAGCCGATCTTTTCGACGGTGGTGAATGTGGAG
AGGAG
GTTCGTGATACACGGGATTTATTTTTACACACTCTGACATTAATCCAGGCCCACTCTGCGCTTCGTCTTGCGTTCCACGACGCAATTGGCTTCTCGATTCACGGTCAGCCGTCTT
TTGATTACTTTATTAACTCATTTTTGATGTTCTCGTGCTTACTTATAGGTGGAAAGTTAGTGTTTTCGCTGTTATTTTCCTTAAATAATCTGACTTCTGCCTAAAGAGGTGGAGGAGCTG
ATGGTTCTATCCTCGTCTTCAACGCGACAGAGCTGAAATTCC
GTAAGTAGTTTTGTTCGTCATAACCCTTTCTCGTCCTGACACTCTATCCCGTATCCAGATGCAAACGGAGGGTAAGCT
CAAATTCATTAATTGACGAAATTTCTTATCAAAATCGCTCAGTATTGACGATATTACGGCCCGCCAATTTCCTGTCTTCCAAGAAACTGGCTTGACACCTGGTGACTTGTAAGTGCAAGG
CCTTTGAATTAAGGATGGATAATGACTTTCGCGTGTAATAGTGTTCATCTCGCGGCCGCCATCGGCACAGGTAACTGCCCTGGTGCTCCAAGGCTCAACTTCTTCTTCGGACGTGCCCCT
CCTAGAGCCCCGGCACCCGATCTTACCGTCCCCGAGCCCACAG
GTTGGCAACACGATTTTCCGTTTTGACTAATTTAATTTGTGTACGTTTAACAGACAGCGTCACGGCGATTCTAGCTA
GGTTTGCGGACGCTGGTTTCAGTCCAGCTGAAGCCGTTGCACTCCTTTCATCTCACACCATTGCTGCCGCT
GTGAGTTTATAACCTAAGTTTAAACTCGTCACTATTGCTAAATCTGTTT
GCTATAGGATGTTGTTGACCCGGTACATAACCTGCTCAGTTCTTATTGAATTAGAAATTGACTACCTTGATTCAATAGACCATCCCAGGAACTCCGTTTGACTCGTAAGTTCGCTTTCCT
GGTTACAGTTTCAAAGTTGTCTGACCAATATTGATACAATGATAGCACCGTTGGTACATTGTAAGCTTATGTTGCTCCATATCCTCCTTGAAGCTTACACACGGACCAAAAGTGACTCCC
AAGTCTTCCTCGAGGTTCTACTGAAGGGACGCCTATTCCCTGG
GTACATAACTTACAAATATTTTCCCTCAGTGTGCTGATTTCTCAACCCTTGCAGAAACGGGAGCCAAACTGGTGAAG
TTCTTTCCCCCATCGCCGGTGAAATGCGTCTGCAAAGCGATTTCGCTATCTCTCAAG
GTTTGGACCTGCTGTAATTTTTGGGCGTTAGGATGTTAATTCAAAATGTACAGATGCTCGCAC
TGCTTGCTTGTGGCAAAACATGATCA
GTATGTATCCTATAAAGCTTTCTCGCTCTACTTGTTGATAACACACTTCATAGACAATCAGAATTTGATGACGACACAGTTCAAGAGTGCTATG
AGCAAACTTCAAGTTCTTGGCCAGCCCAGACTCATAGACTGCTCTGAC
GTACGTTCATTTTACTAAACGAGCCCTCGTTCGACTTCATATCCTTGACCTTTCAGGTTGTCCCTGTGCCCA
AACCATTCGCTGGCCCCATCAAATTCCCCGCCAGCTTCTCGCAGGCTGATGTTCAGATCGCC
GTGAGTACTAGCCGAAAACTGTAGCTTCCTCGCATTTACATAATTTGCCATGATAGTG
CAAGCAATCCCCATTCCCAAGCCTTGCAACCGTAGCGGGTCCTGCTCCCACAGTCCCACCCGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCGCTCGCTTGACCGCTCTCATCTCAATCGCGTTCGCTGCCTCTCAAGTAGCGACTGCTGCCCTCACCAAACGCGTTACATGTTCGAATGGTCATGTAACTGCTAATGCAGCA
TGTTGCA
ATCTCTTCCCAATCGTCGACAAAATTCAAGCCGATCTTTTCGACGGTGGTGAATGTGGAGAGGAGGCCCACTCTGCGCTTCGTCTTGCGTTCCACGACGCAATTGGCTTCTCG
ATTCACGGTCAGCC
AGGTGGAGGAGCTGATGGTTCTATCCTCGTCTTCAACGCGACAGAGCTGAAATTCCATGCAAACGGAGGTATTGACGATATTACGGCCCGCCAATTTCCTGTCTTC
CAAGAAACTGGCTTGACACCTGGTGACTT
TGTTCATCTCGCGGCCGCCATCGGCACAGGTAACTGCCCTGGTGCTCCAAGGCTCAACTTCTTCTTCGGACGTGCCCCTCCTAGAGCCCCG
GCACCCGATCTTACCGTCCCCGAGCCCACAG
ACAGCGTCACGGCGATTCTAGCTAGGTTTGCGGACGCTGGTTTCAGTCCAGCTGAAGCCGTTGCACTCCTTTCATCTCACACCATTGCT
GCCGCT
GATGTTGTTGACCCGACCATCCCAGGAACTCCGTTTGACTCCACCGTTGGTACATTTGACTCCCAAGTCTTCCTCGAGGTTCTACTGAAGGGACGCCTATTCCCTGGAAACGGG
AGCCAAACTGGTGAAGTTCTTTCCCCCATCGCCGGTGAAATGCGTCTGCAAAGCGATTTCGCTATCTCTCAAG
ATGCTCGCACTGCTTGCTTGTGGCAAAACATGATCAACAATCAGAAT
TTGATGACGACACAGTTCAAGAGTGCTATGAGCAAACTTCAAGTTCTTGGCCAGCCCAGACTCATAGACTGCTCTGAC
GTTGTCCCTGTGCCCAAACCATTCGCTGGCCCCATCAAATTC
CCCGCCAGCTTCTCGCAGGCTGATGTTCAGATCGCC
TGCAAGCAATCCCCATTCCCAAGCCTTGCAACCGTAGCGGGTCCTGCTCCCACAGTCCCACCCGTGTAA

Retrieve as FASTA