Entry information : GmarCIIBB02
Entry ID 11878
Creation 2013-05-23 (Nizar Fawal)
Last sequence changes 2016-03-01 (Christophe Dunand)
Sequence status complete
Reviewer Catherine
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: GmarCIIBB02
Name GmarCIIBB02
Class Other class II peroxidase type B    [Orthogroup: CIIBB002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarCIIBB02
start..stop
S start..stop
GmarCIIBB01 665 0 1..355 1..355
HsubCIIBB08 534 0 7..354 10..360
GmarCIIBB06 531 0 1..352 1..357
HsubCIIBB06 528 0 15..354 19..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 744752..744800 49 N° 2 744575..744702 128 N° 3 744471..744526 56 N° 4 744278..744418 141
N° 5 743982..744227 246 N° 6 743897..743931 35 N° 7 743804..743849 46 N° 8 743678..743747 70
N° 9 743572..743617 46 N° 10 743437..743513 77 N° 11 743287..743382 96 N° 12 743170..743234 65
N° 13 743106..743118 13  
complement(join(743106..743118,743170..743234,743287..743382,743437..743513,7435 72..743617,743678..743747,743804..743849,743897..743931,743982..744227,744278..7 44418,744471..744526,744575..744702,744752..744800))


exon

Literature and cross-references GmarCIIBB02
DNA ref. JGI genome:   scaffold_20 (744800..743106)
Cluster/Prediction ref. JGI gene:   142466
Protein sequence: GmarCIIBB02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (338)
PWM (Da):   %s   37338.8 (35307.6)  
PI (pH):   %s   4.37 (4.25) Peptide Signal:   %s   cut: 18 range:18-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFRKALILALPLFVYGLRTKRATCPDGVNTAINAQCCALFPVVKDLVDNFFTNECGDAHGALRLLFHDAIGIGSTGGGGADGSIAVFNETELTFHANLGIDDILDEIGPFMQAHSNVLTPGDFIQLAGAVSLVQCPGAPRIQFLMGRAPPKAASPPNLVPEPFDSVQSILQRFEPLGLTLEETVAVIGGSHSVAGADDVIPDLEGVPFDQTPSVFTQIFVDVQLRGTMFTGQGGNQGEVQSAVAGLVRLQSDHLARDSATNCAWQSFANNQQRIQTFFASGVQKLALLGQNPSMVDCSEVIPSAIAFHGSATLPPGQTMEDIEQACATASFPVLPTQPGPPTTVPAIPQV

Retrieve as FASTA  
Remarks complete sequence from genomics (scaffold_20, 12 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAGAAAGGCACTCATCCTCGCACTCCCTCTCTTTGTCTATGGTTCGTAAACTCAAACCCAGTCATTATCGCGTGCTTATTTCTCTCGTAGGACTAAGGACAAAGCGGGCTAC
ATGCCCAGATGGTGTCAACACTGCCATCAACGCGCAGTGCTGCGCCTTGTTCCCCGTCGTCAAAGATCTAGTGGACAACTTCTTCACCAACGAGTGCGGTGATTCG
GTTGGTAATTGCTT
ATAATTTACTTTCACCATTCTGACGTATTCGTAGGCTCACGGTGCTCTTCGTCTCCTGTTCCACGACGCTATTGGGATTGGTTCAACAGGGTATGTACCCTCAAAATTTCCCTGTCGCTC
ATGCTCAAATTCAAATAAACAGTGGTGGAGGAGCTGATGGCTCTATCGCCGTTTTCAACGAGACTGAGCTGACCTTCCACGCCAACCTCGGGATTGACGATATCCTCGACGAAATAGGCC
CATTCATGCAAGCGCACTCCAATGTCTTGACTCCAGGAGATTT
GTAAGTGAAATTATAGTTCAGGGGACCGCTTTTCACCCACCCTTGTGTAGCATTCAACTTGCCGGTGCGGTCAGCCT
CGTGCAATGCCCGGGTGCACCCCGTATACAATTCCTTATGGGACGTGCCCCACCGAAGGCTGCATCGCCACCCAACCTCGTTCCTGAGCCATTTGACAGTGTCCAGAGCATTCTACAGCG
CTTCGAACCCCTCGGGCTGACATTAGAAGAAACCGTAGCCGTGATCGGCGGTTCTCACAGTGTTGCTGGTGCCGACGACGTTATCCCAGACCTTGAGGG
GTGCGCTTTATATTCTGCTTA
ACAAAACAACATTGCTGACGGCGTTGCAGAGTGCCATTCGATCAGACCCCCTCCGTATTCGACAGTAAGTCTTCAATAAACTATAAATTTAAAATACTCAACCGTCCCCAGCCCAAATCT
TCGTCGACGTGCAGCTTCGTGGCACGATGTTTACTGG
GTATGCATATCAGTTGACCTAGTACAAATGTTCGCTCACCGACTGTGGCATTGTAGGCAAGGAGGAAATCAAGGAGAGGTCCA
ATCTGCCGTCGCCGGTCTAGTGCGATTGCAATCTGACCATCTT
GTAAGCTATTCGTGAAGGTGTAATGAATCTTTACATCAATTAACAATTCTGATTCCACAGCTCGCTCGTGATTCAGC
CACTAACTGTGCATGGCAATCATTCGCCA
GTAAGTGCCCGTCTAATTTTATCGATTAATCTTCTACGCTTATACAAATTGTGTAAAGACAATCAACAAAGGATTCAGACATTCTTTGCAT
CGGGTGTCCAGAAACTTGCACTCTTGGGCCAGAACCCATCAAAG
GTTAGCAGCTCAGAAATACCGCGCGATCGTGCCATAAATAATAATATTTCATAGATGGTGGATTGTAGTGAGGTCA
TTCCCTCAGCTATTGCTTTCCATGGATCAGCCACACTCCCACCCGGCCAGACCATGGAGGATATCGAACAAGCT
GTGAGTTTTTCTGAATTCAATTGCGGGACATATAAAATAACACTCG
AATCAGTGTGCCACCGCGTCATTCCCGGTCTTGCCAACTCAGCCAGGGCCGCCTACCACAGTTCCGGCTATGTGCGCTATTTTACACTCCTTGTATACTCTATGCTAACCCAGAGCTTCC
AGTCCCCAGGTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCAGAAAGGCACTCATCCTCGCACTCCCTCTCTTTGTCTATGGACTAAGGACAAAGCGGGCTACATGCCCAGATGGTGTCAACACTGCCATCAACGCGCAGTGCTGCGCCTTG
TTCCCCGTCGTCAAAGATCTAGTGGACAACTTCTTCACCAACGAGTGCGGTGATTCG
GCTCACGGTGCTCTTCGTCTCCTGTTCCACGACGCTATTGGGATTGGTTCAACAGGTGGTGGA
GGAGCTGATGGCTCTATCGCCGTTTTCAACGAGACTGAGCTGACCTTCCACGCCAACCTCGGGATTGACGATATCCTCGACGAAATAGGCCCATTCATGCAAGCGCACTCCAATGTCTTG
ACTCCAGGAGATTT
CATTCAACTTGCCGGTGCGGTCAGCCTCGTGCAATGCCCGGGTGCACCCCGTATACAATTCCTTATGGGACGTGCCCCACCGAAGGCTGCATCGCCACCCAACCTC
GTTCCTGAGCCATTTGACAGTGTCCAGAGCATTCTACAGCGCTTCGAACCCCTCGGGCTGACATTAGAAGAAACCGTAGCCGTGATCGGCGGTTCTCACAGTGTTGCTGGTGCCGACGAC
GTTATCCCAGACCTTGAGGG
AGTGCCATTCGATCAGACCCCCTCCGTATTCGACACCCAAATCTTCGTCGACGTGCAGCTTCGTGGCACGATGTTTACTGGGCAAGGAGGAAATCAAGGA
GAGGTCCAATCTGCCGTCGCCGGTCTAGTGCGATTGCAATCTGACCATCTT
CTCGCTCGTGATTCAGCCACTAACTGTGCATGGCAATCATTCGCCAACAATCAACAAAGGATTCAGACA
TTCTTTGCATCGGGTGTCCAGAAACTTGCACTCTTGGGCCAGAACCCATCAAAG
ATGGTGGATTGTAGTGAGGTCATTCCCTCAGCTATTGCTTTCCATGGATCAGCCACACTCCCACCC
GGCCAGACCATGGAGGATATCGAACAAGCT
TGTGCCACCGCGTCATTCCCGGTCTTGCCAACTCAGCCAGGGCCGCCTACCACAGTTCCGGCTATTCCCCAGGTTTAG

Retrieve as FASTA