Entry information : GmarCIIBC07
Entry ID 11879
Creation 2013-05-23 (Nizar Fawal)
Last sequence changes 2016-03-10 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2017-04-19 (Catherine Mathe (Scipio))
Peroxidase information: GmarCIIBC07
Name GmarCIIBC07
Class Other class II peroxidase type C    [Orthogroup: CIIBC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarCIIBC07
start..stop
S start..stop
GmarCIIBC 597 0 1..357 1..354
GmarCIIBC09 597 0 1..360 1..359
HsubCIIBC03 570 0 1..360 1..358
GmarCIIBC06 570 0 1..357 1..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 169673..169802 130 N° 2 169551..169615 65 N° 3 169432..169493 62 N° 4 169326..169381 56
N° 5 169259..169271 13 N° 6 169143..169208 66 N° 7 168871..169087 217 N° 8 168777..168817 41
N° 9 168713..168727 15 N° 10 168492..168658 167 N° 11 168344..168438 95 N° 12 168208..168285 78
N° 13 168083..168147 65 N° 14 168017..168029 13  
complement(join(168017..168029,168083..168147,168208..168285,168344..168438,1684 92..168658,168713..168727,168777..168817,168871..169087,169143..169208,169259..1 69271,169326..169381,169432..169493,169551..169615,169673..169802))


exon

Literature and cross-references GmarCIIBC07
DNA ref. JGI genome:   scaffold_24 (169802..168017)
Cluster/Prediction ref. JGI gene:   143334
Protein sequence: GmarCIIBC07
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (338)
PWM (Da):   %s   37883.15 (35565.9)  
PI (pH):   %s   5.85 (5.59) Peptide Signal:   %s   cut: 23 range:23-360
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSRLSAILTIAIAATQSVNAAAAAKPHICASGHVTANAACCVLFPMVDKLQKDLFDGGECGEEAHSALRLSFHDAIGFSIHGGKGGGADGSILVFNATEEKFHANGGIDDITARQFPVFQELKLSAGDFVHLAAAVGTANCPGAPRLEFMFGRPPPKAAAPDLTIPEPTDDVTKILARFKDAGFSPREAVALLSSHTIAAADVVDVTIPGTPFDSTVGTFDTQVFLEVLLKGRLFPGNGSQAGEVQSPLAGEMRLQSDFAISQDSRTACFWQAMINDQQRMVNEFRAAMSKLQTLGQNRDKLTDCSDVVPVPAPFTKNIKFPASFKKKDVQIACPDLPFPSLATVSGPAPTVPPVPGS*

Retrieve as FASTA  
Remarks Complete sequence from genomics (13 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCTCTCGTCTTTCGGCAATTCTTACAATTGCGATTGCAGCAACGCAATCTGTAAACGCAGCAGCAGCCGCGAAGCCGCATATCTGCGCCTCTGGACATGTTACTGCGAACGCA
GCATGTTGCG
GTAAGTTCATAGACGTATTTTCAAGTATCTGGACTGAGTTCTGATCTTTGGGTTTAGTTCTTTTCCCTATGGTCGACAAACTACAAAAAGATCTCTTCGATGGAGGTGAA
TGTGGCGAAGAG
GTATATATTTTCTATTTCGAAATCGCTTTGACCGTTGACCTAGCCATTTTTATATAGGCACACTCTGCTCTTCGTCTTTCATTCCACGACGCCATTGGTTTCTCTATT
CATGGCGGAAA
GTGAGTCTAAATTCCTGATTTTTTAACCGGTTTTTCATATTATGGTCCAGGGGTGGAGGCGCAGATGGCTCCATCTTGGTCTTCAATGCGACAGAAGAGAAGTTCCGTA
AGCTGTTCCACGTCGCAGTCATTTTCATTGACTGAATACTATTCATTGTAGATGCCAATGGAGGGTAAATTCTGGAAATTCGGAACCACGCTCGCAGCTCACTAATTTTCTTAGCATCGA
CGATATCACTGCTCGTCAATTCCCAGTATTCCAAGAGCTCAAGTTGAGCGCTGGAGACTT
GTAAGCCATTTTTCTTCATGTCAGTAATATCGAAATCGTAATAATTTTTATCAAGCGTTC
ACCTGGCAGCAGCTGTCGGAACAGCCAACTGTCCCGGTGCACCGAGGCTCGAATTTATGTTTGGCCGACCGCCACCAAAAGCTGCTGCTCCGGATTTGACCATACCCGAGCCAACAGACG
ACGTAACGAAAATCCTCGCGAGATTCAAGGATGCTGGCTTTTCCCCGAGGGAAGCTGTTGCGCTCCTTTCGTCGCACACGATCGCCGCTGCA
GTATGTATCATGCAAGACGTATCAGTGA
TAAGCTTTTATTCACGTTGGCTCAGGATGTTGTTGACGTGACGATTCCTGGAACGCCGTTCGACTCGTGAGTGCGTATTGCATCCATTTCTACATATTCTAACACCCTGGCACAGCACCG
TCGGTACTTT
GTGAGTCGCTCCTCTACTTGACTAAAAAGAATTGCTCACATAGAAAAAATCCAGCGACACTCAAGTCTTTCTTGAGGTTCTTCTCAAAGGCCGTCTTTTCCCTGGAAATG
GATCCCAAGCAGGAGAGGTCCAGTCTCCCCTCGCAGGCGAAATGCGTCTGCAGAGCGATTTCGCTATCTCTCAGGATTCTAGAACCGCGTGTTTCTGGCAGGCTATGATCA
GTAAGTACT
GGAAGCTGAGCATCGACGCCGAATTCGGACTGATATTCCAATAGACGATCAACAGCGCATGGTAAATGAATTCCGGGCTGCCATGTCTAAGCTTCAAACACTCGGGCAGAACAGAGATAA
GCTCACCGACTGCTCTGAT
GTAAGTACACATTTCCTTGCCGTTCGGATCTACGCACTATTAACGCTTGTCATATTAGGTTGTCCCCGTTCCGGCGCCGTTCACCAAGAACATCAAGTTCC
CTGCCAGCTTCAAGAAGAAGGACGTGCAGATTGCG
GTGTGTATTGCCGCTCAAATTGTTTCCCAGCTATTCCACTGAATTTGCATACCTTTACAGTGCCCAGACCTTCCATTCCCGAGCC
TTGCTACCGTTTCCGGACCCGCTCCCACTGTCCCGCCTGT
GTGAGCGAGATTTACCTTAGACTTGATTTCGAATCTGATAACTAGTCTACCAGTCCCGGGTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCTCTCGTCTTTCGGCAATTCTTACAATTGCGATTGCAGCAACGCAATCTGTAAACGCAGCAGCAGCCGCGAAGCCGCATATCTGCGCCTCTGGACATGTTACTGCGAACGCA
GCATGTTGCG
TTCTTTTCCCTATGGTCGACAAACTACAAAAAGATCTCTTCGATGGAGGTGAATGTGGCGAAGAGGCACACTCTGCTCTTCGTCTTTCATTCCACGACGCCATTGGTTTC
TCTATTCATGGCGGAAA
GGGTGGAGGCGCAGATGGCTCCATCTTGGTCTTCAATGCGACAGAAGAGAAGTTCCATGCCAATGGAGGCATCGACGATATCACTGCTCGTCAATTCCCAGTA
TTCCAAGAGCTCAAGTTGAGCGCTGGAGACTT
CGTTCACCTGGCAGCAGCTGTCGGAACAGCCAACTGTCCCGGTGCACCGAGGCTCGAATTTATGTTTGGCCGACCGCCACCAAAAGCT
GCTGCTCCGGATTTGACCATACCCGAGCCAACAGACGACGTAACGAAAATCCTCGCGAGATTCAAGGATGCTGGCTTTTCCCCGAGGGAAGCTGTTGCGCTCCTTTCGTCGCACACGATC
GCCGCTGCA
GATGTTGTTGACGTGACGATTCCTGGAACGCCGTTCGACTCCACCGTCGGTACTTTCGACACTCAAGTCTTTCTTGAGGTTCTTCTCAAAGGCCGTCTTTTCCCTGGAAAT
GGATCCCAAGCAGGAGAGGTCCAGTCTCCCCTCGCAGGCGAAATGCGTCTGCAGAGCGATTTCGCTATCTCTCAGGATTCTAGAACCGCGTGTTTCTGGCAGGCTATGATCA
ACGATCAA
CAGCGCATGGTAAATGAATTCCGGGCTGCCATGTCTAAGCTTCAAACACTCGGGCAGAACAGAGATAAGCTCACCGACTGCTCTGAT
GTTGTCCCCGTTCCGGCGCCGTTCACCAAGAAC
ATCAAGTTCCCTGCCAGCTTCAAGAAGAAGGACGTGCAGATTGCG
TGCCCAGACCTTCCATTCCCGAGCCTTGCTACCGTTTCCGGACCCGCTCCCACTGTCCCGCCTGTTCCCGGGTCC
TAA

Retrieve as FASTA