Entry information : GmarCIIBC10
Entry ID 11882
Creation 2013-05-23 (Nizar Fawal)
Last sequence changes 2016-03-10 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2017-04-27 (Catherine Mathe)
Peroxidase information: GmarCIIBC10
Name GmarCIIBC10
Class Other class II peroxidase type C    [Orthogroup: CIIBC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarCIIBC10
start..stop
S start..stop
GmarCIIBC14 632 0 1..359 1..357
GmarCIIBC12 623 0 1..356 1..354
GmarCIIBC09 607 0 1..359 1..359
GmarCIIBC 602 0 1..356 1..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 744667..744793 127 N° 2 744493..744612 120 N° 3 744434..744440 7 N° 4 744329..744384 56
N° 5 744265..744277 13 N° 6 744146..744211 66 N° 7 743879..744095 217 N° 8 743785..743825 41
N° 9 743717..743731 15 N° 10 743498..743664 167 N° 11 743348..743442 95 N° 12 743207..743284 78
N° 13 743084..743148 65 N° 14 743009..743021 13  
complement(join(743009..743021,743084..743148,743207..743284,743348..743442,7434 98..743664,743717..743731,743785..743825,743879..744095,744146..744211,744265..7 44277,744329..744384,744434..744440,744493..744612,744667..744793))


exon

Literature and cross-references GmarCIIBC10
DNA ref. JGI genome:   scaffold_3 (744793..743012)
Cluster/Prediction ref. JGI gene:   134156
Protein sequence: GmarCIIBC10
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360 (337)
PWM (Da):   %s   37400.01 (35132.8)  
PI (pH):   %s   6.39 (5.89) Peptide Signal:   %s   cut: 23 range:23-359
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFPRLSAIVAIALAASQAARASLTKRVTCASGHVTANAACCALFPIVDKIQADLFDGGECGEEAHSALRISFHDAIGFSIYGGKGGGADGSILAFNKTETAFHANGGIDDIVDRQFPVFLETGLSAGDFIHLAAAIGTGNCPGAPRLQFMFGRPPPKAAAPDLTIPEPTDSVTKILARFADAGFSPREAVALLASHTIAAADVVDATIPGTPFDSTVGTFDSQVFLEVLLKGNLFPGNGSQSGEVLSPLHGEMRLQSDFAISQDKRTACFWQAMINNQKFMMSEFKAAMAKLQVLGQNTKKLIDCSDVVPVPKPFTAAIKFPATFSKKDVQIACPQSAFPSLATVAGPAPTVPPVPGS*

Retrieve as FASTA  
Remarks complete sequence from genomics (13 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTCCCCGTCTGTCAGCTATTGTAGCTATTGCTCTCGCAGCATCCCAGGCTGCTAGAGCATCTCTCACCAAGCGCGTTACATGCGCATCTGGTCATGTTACTGCCAACGCTGCC
TGCTGTG
GTAGGTGTATCTTCGATTTCCAGCGCAATTTTTTGATTTAATTTATGATATTAGCACTGTTCCCTATCGTCGACAAAATTCAGGCGGATCTATTCGACGGTGGCGAGTGCGGC
GAGGAGGCTCACTCTGCTCTTCGTATCTCTTTCCACGATGCTATTGGTTTCTCCATCTACG
GTTTGTTGAATTTCTTTGCAGAGGTTACACGTAGCTCACTTTTTACTTTCAGGTGGAAA
GTTAGTCATGCGAACGCATCGCATATAAATCTATCTAACTTTTTGACAGGGGTGGAGGTGCTGACGGCTCCATCTTGGCCTTCAATAAGACAGAAACCGCGTTCCGTAAGTGCTGAGAAC
ATCAAGTTGAAATTTCCTGAAAATGTACTTTTCCAGACGCGAACGGAGGGTAACTGAACTTTTCTCCAGTTTCGAATCTTATTTTTAACCACTATATTTCAGAATCGATGACATCGTCGA
TCGTCAATTCCCGGTCTTCCTGGAGACAGGTTTGAGCGCCGGTGACTT
GTGAGTATTGTCCAAGCACTCTATGCGCATGTGCTGACTTTTCTTCCCAGTATCCATCTTGCTGCTGCAATC
GGCACAGGTAACTGCCCCGGTGCTCCTCGGCTCCAATTTATGTTTGGCCGCCCGCCACCGAAGGCTGCTGCCCCGGATCTCACTATTCCTGAGCCCACCGACAGCGTTACCAAGATTTTG
GCCCGTTTTGCCGATGCTGGTTTCTCGCCAAGAGAGGCTGTCGCTCTTCTTGCGTCGCACACTATCGCTGCCGCC
GTGAGTTTATTTATTCGACCAATGATTTTCAATATACTAATGAAG
AGCCACAGGATGTTGTGGACGCAACCATCCCTGGAACTCCCTTCGATTCGTAAGTTTCTACAATTAACAACTCTTGGAAGGTATCCTGACATTACGCTTGAGTACGGTCGGAACATTGTA
AGGAAAACAATCCTTGTTATCTGAAAGTGCTTGAAATATTGGAAAACAGCGATTCTCAGGTCTTCCTCGAAGTTCTCCTCAAGGGCAACCTGTTCCCCGGTAACGGATCTCAATCCGGTG
AAGTATTGTCTCCGCTCCACGGGGAGATGCGTCTCCAGAGTGACTTCGCCATTTCCCAAGACAAGAGGACAGCATGCTTCTGGCAGGCGATGATCA
GTAAGGAGCCACGTCCCTTATTCT
TTGCCATTTTAAAAAAACTTTCGGTGAACAGACAACCAGAAATTCATGATGTCAGAATTTAAGGCTGCAATGGCTAAGCTCCAGGTTTTGGGCCAAAACACCAAGAAGCTCATTGATTGC
TCTGAC
GTACGCGTTTTTCTTTTTTTTTTGTCCGGGCTAATAGGTCTGTTTCATTGGCTCTCTCTGCAGGTTGTTCCCGTTCCCAAGCCATTCACAGCCGCGATCAAGTTCCCCGCCACC
TTCTCAAAGAAGGACGTCCAGATTGCT
GTGAGTATTTATCTAAATTTCCCCAAATATTTTCCTCATCTCCATTGCTTCTACCAAGTGCCCACAGTCTGCATTCCCCAGCCTCGCCACCGT
CGCAGGGCCCGCTCCCACCGTCCCCCCTGT
GTAAGTTTATTAATGTACTACTAATTTAGTGTTGCTAACTGACCGACGATTGTGTCTTACAGCCCAGGCTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTCCCCGTCTGTCAGCTATTGTAGCTATTGCTCTCGCAGCATCCCAGGCTGCTAGAGCATCTCTCACCAAGCGCGTTACATGCGCATCTGGTCATGTTACTGCCAACGCTGCC
TGCTGTG
CACTGTTCCCTATCGTCGACAAAATTCAGGCGGATCTATTCGACGGTGGCGAGTGCGGCGAGGAGGCTCACTCTGCTCTTCGTATCTCTTTCCACGATGCTATTGGTTTCTCC
ATCTACG
GTGGAAAGGGTGGAGGTGCTGACGGCTCCATCTTGGCCTTCAATAAGACAGAAACCGCGTTCCACGCGAACGGAGGAATCGATGACATCGTCGATCGTCAATTCCCGGTCTTC
CTGGAGACAGGTTTGAGCGCCGGTGACTT
TATCCATCTTGCTGCTGCAATCGGCACAGGTAACTGCCCCGGTGCTCCTCGGCTCCAATTTATGTTTGGCCGCCCGCCACCGAAGGCTGCT
GCCCCGGATCTCACTATTCCTGAGCCCACCGACAGCGTTACCAAGATTTTGGCCCGTTTTGCCGATGCTGGTTTCTCGCCAAGAGAGGCTGTCGCTCTTCTTGCGTCGCACACTATCGCT
GCCGCC
GATGTTGTGGACGCAACCATCCCTGGAACTCCCTTCGATTCTACGGTCGGAACATTCGATTCTCAGGTCTTCCTCGAAGTTCTCCTCAAGGGCAACCTGTTCCCCGGTAACGGA
TCTCAATCCGGTGAAGTATTGTCTCCGCTCCACGGGGAGATGCGTCTCCAGAGTGACTTCGCCATTTCCCAAGACAAGAGGACAGCATGCTTCTGGCAGGCGATGATCA
ACAACCAGAAA
TTCATGATGTCAGAATTTAAGGCTGCAATGGCTAAGCTCCAGGTTTTGGGCCAAAACACCAAGAAGCTCATTGATTGCTCTGAC
GTTGTTCCCGTTCCCAAGCCATTCACAGCCGCGATC
AAGTTCCCCGCCACCTTCTCAAAGAAGGACGTCCAGATTGCT
TGCCCACAGTCTGCATTCCCCAGCCTCGCCACCGTCGCAGGGCCCGCTCCCACCGTCCCCCCTGTCCCAGGCTCTTGA

Retrieve as FASTA