Entry information : GmarCIIBB03
Entry ID 11887
Creation 2013-05-23 (Nizar Fawal)
Last sequence changes 2013-05-23 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: GmarCIIBB03
Name GmarCIIBB03
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarCIIBB03
start..stop
S start..stop
GmarCIIBB04 582 0 1..360 1..360
GmarCIIBB05 546 0 21..349 15..343
HsubCIIBB08 470 2e-167 1..360 1..361
HsubCIIBB01 465 2e-165 1..360 1..362
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 772147..772207 61 N° 2 771972..772099 128 N° 3 771860..771918 59 N° 4 771666..771806 141
N° 5 771371..771613 243 N° 6 771286..771320 35 N° 7 771192..771237 46 N° 8 771071..771140 70
N° 9 770975..771020 46 N° 10 770843..770919 77 N° 11 770685..770783 99 N° 12 770566..770630 65
N° 13 770506..770518 13  
complement(join(770506..770518,770566..770630,770685..770783,770843..770919,7709 75..771020,771071..771140,771192..771237,771286..771320,771371..771613,771666..7 71806,771860..771918,771972..772099,772147..772207))


exon

Literature and cross-references GmarCIIBB03
DNA ref. JGI genome:   scaffold_24 (772207..770506)
Cluster/Prediction ref. JGI gene:   281593
Protein sequence: GmarCIIBB03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (339)
PWM (Da):   %s   37303.9 (35020.7)  
PI (pH):   %s   4.65 (4.57) Peptide Signal:   %s   cut: 22 range:22-360
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFSKGLSVLFFSLSLVLVNGLITKRAACPGSTHTAVNAKCCFLFPIVDDLLVNLFDGDCGDAHGALRLVFHDAIGISPKLGGGGADGSISTFNETELTFGSNAGIDDILDVIGPFIQKYSHVLSPGDFIQLAGALSLTNCAGAPRVKFMFGRPQPKAASPPGLIPDPEDNVDKILARFKEVGFSPTEVVALLASHSVAGADDVDPGIPGTPFDSTPDIFSQFFVDVQLRGTGFAGTGGHSGEVESGIQGVLRLQSDHLARDSATSCIWQGFVNQQSKLQSAFGAALFKLSLLGQKASLTDCSEVIPPSLAFNGASARFPPGKSIADIEQACATASFPVLPTVPGPPTAVPPIPQS

Retrieve as FASTA  
Remarks complete sequence from genomics (12 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCAGTAAAGGTCTCTCCGTCTTGTTCTTCTCCCTTTCTCTGGTTCTTGTCAACGGTATGCATGCTCCCCGTCATAAATCCATGCTCTGATCGTTGCTCTAGGTTTGATAACCA
AGCGGGCAGCGTGTCCAGGAAGTACACATACCGCCGTAAACGCGAAATGCTGTTTCCTGTTCCCCATCGTCGACGATTTGCTCGTCAACTTATTCGACGGTGACTGCGGTGACGAG
GTTT
GTATTTTTTTTTTGGTGTTAAGCCCGATATTTTTCTGACTTTCGCTAAGGCTCACGGCGCTCTTCGTCTCGTGTTCCATGATGCCATTGGAATATCTCCGAAATTAGGGTATGCGCCTTT
TTAATACGCGAATATTGCAATTACTGAGGTAAAAATAACAGAGGTGGAGGAGCAGATGGATCTATCTCTACCTTCAATGAAACGGAACTAACCTTCGGCTCGAACGCTGGTATCGACGAC
ATCCTGGACGTTATCGGGCCGTTCATCCAGAAATATTCCCACGTTTTGAGCCCTGGAGACTT
GTTCGTTGTCCTCCGAAATTTTTGACCTATTTAACTGACTTTCATCACGCAGCATCCA
ACTCGCTGGTGCACTGAGTCTTACCAACTGTGCTGGAGCGCCTCGCGTAAAGTTCATGTTTGGACGTCCTCAACCGAAAGCAGCCTCGCCCCCAGGTCTCATCCCCGATCCAGAAGATAA
TGTGGATAAGATCTTGGCTCGTTTCAAAGAAGTTGGTTTCTCCCCAACCGAGGTAGTAGCCCTCCTTGCATCCCACAGTGTTGCTGGTGCCGATGATGTTGACCCTGGTATTCCCGG
GTG
AGCTTCATTGTTCTCACCGAACCGGAACTTCGCTCACAAGTTTTTAGAACGCCGTTCGATTCTACACCAGATATATTTGACAGTGAGGGTACTTCAATTTGAAAACTGATCAGCACTAAA
GTTTTACAAGGCCAATTTTTCGTCGACGTGCAACTTCGTGGCACAGGTTTCGCTGGGTATGTGGCATTCTGTTCGAGAGATAATTTTCGCTTACCCTATTGTGATAGTACTGGAGGCCAT
TCAGGAGAAGTGGAGTCCGGTATTCAGGGAGTACTGCGTTTACAGTCTGACCACAAC
GTGAGTCATTCCATCGCTTATTCGCTGTTTCTCGGTTTAAAATTTCTCAGTTGGCTCGCGATT
CAGCGACTAGCTGTATCTGGCAGGGTTTCGTCA
GTGAGTCGTCACTCTTAAATCACTACAAAACCAGTGTTGAATAAATACATACCAGACCAGCAGAGCAAGTTGCAATCAGCCTTTGGT
GCCGCCCTTTTCAAGCTTTCCCTCTTGGGTCAGAAAGCCTCTTCG
GTATGTTATAAACGTCGCATTTCTCTGCAAAAAATAACACTCACCCTAAATTTGTACAGCTGACCGACTGTAGCG
AGGTGATCCCTCCGTCTCTTGCTTTCAATGGTGCTTCGGCGCGATTCCCGCCAGGGAAATCCATTGCTGATATAGAACAGGCC
GTAAGTTGGATATTCTTCGCCGACTCGCTAAGTATTT
ACTAAAGTTGCGATTAGTGTGCTACTGCGTCATTCCCCGTTCTTCCTACGGTGCCAGGGCCACCCACTGCCGTCCCTCCCATGTAAGTTAGAACTTCGTACCATTCCTTCTTTGCTAATC
TCTTCTTAGTCCGCAATCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCAGTAAAGGTCTCTCCGTCTTGTTCTTCTCCCTTTCTCTGGTTCTTGTCAACGGTTTGATAACCAAGCGGGCAGCGTGTCCAGGAAGTACACATACCGCCGTAAACGCGAAA
TGCTGTTTCCTGTTCCCCATCGTCGACGATTTGCTCGTCAACTTATTCGACGGTGACTGCGGTGACGAG
GCTCACGGCGCTCTTCGTCTCGTGTTCCATGATGCCATTGGAATATCTCCG
AAATTAGG
AGGTGGAGGAGCAGATGGATCTATCTCTACCTTCAATGAAACGGAACTAACCTTCGGCTCGAACGCTGGTATCGACGACATCCTGGACGTTATCGGGCCGTTCATCCAGAAA
TATTCCCACGTTTTGAGCCCTGGAGACTT
CATCCAACTCGCTGGTGCACTGAGTCTTACCAACTGTGCTGGAGCGCCTCGCGTAAAGTTCATGTTTGGACGTCCTCAACCGAAAGCAGCC
TCGCCCCCAGGTCTCATCCCCGATCCAGAAGATAATGTGGATAAGATCTTGGCTCGTTTCAAAGAAGTTGGTTTCTCCCCAACCGAGGTAGTAGCCCTCCTTGCATCCCACAGTGTTGCT
GGTGCCGATGATGTTGACCCTGGTATTCCCGG
AACGCCGTTCGATTCTACACCAGATATATTTGACAGCCAATTTTTCGTCGACGTGCAACTTCGTGGCACAGGTTTCGCTGGTACTGGA
GGCCATTCAGGAGAAGTGGAGTCCGGTATTCAGGGAGTACTGCGTTTACAGTCTGACCACAAC
TTGGCTCGCGATTCAGCGACTAGCTGTATCTGGCAGGGTTTCGTCAACCAGCAGAGC
AAGTTGCAATCAGCCTTTGGTGCCGCCCTTTTCAAGCTTTCCCTCTTGGGTCAGAAAGCCTCTTCG
CTGACCGACTGTAGCGAGGTGATCCCTCCGTCTCTTGCTTTCAATGGTGCTTCG
GCGCGATTCCCGCCAGGGAAATCCATTGCTGATATAGAACAGGCC
TGTGCTACTGCGTCATTCCCCGTTCTTCCTACGGTGCCAGGGCCACCCACTGCCGTCCCTCCCATTCCGCAATCT
TAA

Retrieve as FASTA