Entry information : GmarCIIBB05
Entry ID 11891
Creation 2013-05-24 (Nizar Fawal)
Last sequence changes 2013-05-24 (Nizar Fawal)
Sequence status complete
Reviewer Catherine
Last annotation changes 2019-05-10 (Catherine )
Peroxidase information: GmarCIIBB05
Name GmarCIIBB05
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarCIIBB05
start..stop
S start..stop
GmarCIIBB04 589 0 15..343 21..349
GmarCIIBB03 546 0 15..343 21..349
HsubCIIBB08 461 3e-164 15..343 21..350
HsubCIIBB04 455 1e-161 16..343 22..351
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 838727..838897 171 N° 2 838947..839005 59 N° 3 839055..839195 141 N° 4 839245..839487 243
N° 5 839536..839570 35 N° 6 839622..839667 46 N° 7 839719..839788 70 N° 8 839839..839884 46
N° 9 839940..840016 77 N° 10 840067..840165 99 N° 11 840218..840286 69  
join(838727..838897,838947..839005,839055..839195,839245..839487,839536..839570, 839622..839667,839719..839788,839839..839884,839940..840016,840067..840165,84021 8..840286)


exon

Literature and cross-references GmarCIIBB05
DNA ref. JGI genome:   scaffold_12 (838727..840286)
Cluster/Prediction ref. JGI gene:   1328628
Protein sequence: GmarCIIBB05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352
PWM (Da):   %s   36521.13  
PI (pH):   %s   4.7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHSTRSFYALNFPAGLRTKRATCPDGVNTATNAKCCFLFPIVEDLSTNLFDGECGDEAHGALRLMFHDAIGISPKTGGGGADGSIATFNATELAFGANAGIDDILDVVGPFLQKYSNVLTPGDFIQLAGAVSLTHCAGAPRVKFSLGRPAPKAASPPNLVPDPFDNVATILARFGEVGFSPAEVVALLASHSVAGADDVDPGIPGTPFDSTPNVFTQFFVDVQLRGTLFPGSGGHQGEVMSGIAGELRLQSDHFARDSATNCLFQGFVNQQSKLQTAFGAALFKLSVLGQNTAMTDCSEVIPQPLALSGSSARFPPGKSLSDIEQACATASFPALQTVPGMNSLPLYR*

Retrieve as FASTA  
Remarks complete sequence from genomics (10 introns). Probably incorrect prediction of 3' end : GPPTAVP is found,
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCAACTCGTTCATTTTATGCTCTAAACTTCCCTGCAGGTCTAAGAACGAAGCGGGCAACATGTCCAGACGGTGTCAACACCGCCACGAACGCTAAATGCTGTTTCCTCTTCCCC
ATCGTGGAAGATTTGTCTACCAACTTATTCGACGGTGAATGTGGTGACGAG
GTCCGTTTTTCTCGAGGTAATATGTACGGAAAATCTAATTGTTATATAGGCACATGGCGCTCTTCGTCT
TATGTTCCATGACGCCATTGGAATTTCTCCAAAAACGGG
GTATGTAGACTATTCAATATCGTGGCAAATACTCAATCAAAATCGACAGTGGCGGAGGTGCAGACGGTTCCATCGCCACTT
TCAACGCAACAGAACTGGCCTTCGGCGCTAACGCCGGCATTGACGACATCCTTGATGTTGTCGGGCCGTTCTTGCAGAAGTATTCCAACGTCTTAACTCCAGGAGACTT
GTGGGTATCAT
CCGAGATTATTTAAACAGTATATAACCTGTCTCTTTAGTATCCAGCTTGCCGGGGCGGTCAGTCTTACGCACTGTGCCGGGGCGCCTCGCGTCAAATTTTCCCTTGGAAGGCCGGCACCG
AAGGCAGCATCGCCACCTAACCTTGTCCCTGACCCCTTCGACAATGTTGCCACGATTTTGGCGCGTTTCGGTGAAGTAGGCTTCTCCCCTGCAGAGGTAGTAGCCTTGCTAGCTTCCCAC
AGTGTAGCTGGTGCAGACGATGTAGACCCCGGCATCCCTGG
GTAAGCTTCCCTTGTATGCGGTCATTAAATTGTCCTGAAAATGTCCAGGACGCCATTTGATTCAACACCAAATGTCTTC
GACA
GTAAGATATAATTTCGCTTCATGACGGAACAAGGACTAACATATTTCGTAGCTCAATTCTTCGTCGACGTACAACTCCGGGGCACCCTCTTCCCTGGGTAAGTCGAATATTTTGCT
TACCTGTAAACTTCGTTCACAACGGTTGGCAGTTCTGGAGGTCATCAGGGTGAAGTAATGTCGGGTATTGCGGGCGAATTACGCTTGCAATCTGATCACAATGTGAGTCACTTGCAGTTG
TTCGTCATTTGTTACTTATCCAGCTTTCGAAGTTCGCCCGTGACTCCGCAACCAACTGTCTCTTCCAAGGTTTCGTCAGTGAGTATTCCATGCTTTGCTGAACTGAATAAATATTAAATA
ACCTGAAATTCAGACCAACAATCTAAGCTACAAACGGCCTTCGGAGCAGCGTTATTTAAGCTATCTGTATTGGGCCAAAACACCGCTGCGGTTAGTAGTGAATAATTGGACGGCTTTACC
AGCGCTTGACATTTGCACAGATGACCGACTGTAGCGAGGTAATTCCCCAGCCTCTTGCGCTCAGTGGTAGTTCAGCAAGATTTCCCCCAGGGAAATCATTGTCTGACATCGAGCAAGCGG
TACGTTATTTTAACTTCTAGCGTCGGGTATAGAAATTAACGACGCGGACAGTGTGCTACAGCATCATTCCCAGCTCTCCAGACTGTACCAGGTATGAATTCACTTCCCCTTTATCGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCAACTCGTTCATTTTATGCTCTAAACTTCCCTGCAGGTCTAAGAACGAAGCGGGCAACATGTCCAGACGGTGTCAACACCGCCACGAACGCTAAATGCTGTTTCCTCTTCCCC
ATCGTGGAAGATTTGTCTACCAACTTATTCGACGGTGAATGTGGTGACGAG
GCACATGGCGCTCTTCGTCTTATGTTCCATGACGCCATTGGAATTTCTCCAAAAACGGGTGGCGGAGGT
GCAGACGGTTCCATCGCCACTTTCAACGCAACAGAACTGGCCTTCGGCGCTAACGCCGGCATTGACGACATCCTTGATGTTGTCGGGCCGTTCTTGCAGAAGTATTCCAACGTCTTAACT
CCAGGAGACTT
TATCCAGCTTGCCGGGGCGGTCAGTCTTACGCACTGTGCCGGGGCGCCTCGCGTCAAATTTTCCCTTGGAAGGCCGGCACCGAAGGCAGCATCGCCACCTAACCTTGTC
CCTGACCCCTTCGACAATGTTGCCACGATTTTGGCGCGTTTCGGTGAAGTAGGCTTCTCCCCTGCAGAGGTAGTAGCCTTGCTAGCTTCCCACAGTGTAGCTGGTGCAGACGATGTAGAC
CCCGGCATCCCTGG
GACGCCATTTGATTCAACACCAAATGTCTTCGACACTCAATTCTTCGTCGACGTACAACTCCGGGGCACCCTCTTCCCTGGTTCTGGAGGTCATCAGGGTGAAGTA
ATGTCGGGTATTGCGGGCGAATTACGCTTGCAATCTGATCACAAT
TTCGCCCGTGACTCCGCAACCAACTGTCTCTTCCAAGGTTTCGTCAACCAACAATCTAAGCTACAAACGGCCTTC
GGAGCAGCGTTATTTAAGCTATCTGTATTGGGCCAAAACACCGCTGCG
ATGACCGACTGTAGCGAGGTAATTCCCCAGCCTCTTGCGCTCAGTGGTAGTTCAGCAAGATTTCCCCCAGGG
AAATCATTGTCTGACATCGAGCAAGCG
TGTGCTACAGCATCATTCCCAGCTCTCCAGACTGTACCAGGTATGAATTCACTTCCCCTTTATCGTTAA

Retrieve as FASTA