Entry information : GmarAPx-CcP03
Entry ID 11911
Creation 2013-05-27 (Christophe Dunand)
Last sequence changes 2013-05-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-19 (Catherine Mathe (Scipio))
Peroxidase information: GmarAPx-CcP03
Name GmarAPx-CcP03
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarAPx-CcP03
start..stop
S start..stop
GmarAPx-CcP05 723 0 1..586 1..580
GmarAPx-CcP07 701 0 18..581 18..575
HcyAPx-CcP03 570 0 17..598 19..595
GmarAPx-CcP02 531 0 1..467 9..477
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 604979..605197 219 N° 2 605251..605337 87 N° 3 605386..605452 67 N° 4 605508..605820 313
N° 5 605878..605991 114 N° 6 606057..606231 175 N° 7 606283..606678 396 N° 8 606735..607172 438
join(604979..605197,605251..605337,605386..605452,605508..605820,605878..605991, 606057..606231,606283..606678,606735..607172)


exon

Literature and cross-references GmarAPx-CcP03
DNA ref. JGI genome:   scaffold_23 (604979..607172)
Cluster/Prediction ref. JGI gene:   253196
Protein sequence: GmarAPx-CcP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   603 (584)
PWM (Da):   %s   64751.28 (62789.1)  
PI (pH):   %s   4.68 (4.73) Peptide Signal:   %s   cut: 19 range:19-602
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVLVPFIVLSSVLTAALAYTWPSPQYDALEKFLYEGTDVNGNFIAFITTHCVHRTTPASGRHPSTVAAEWLRLAYHDAATHNVTDGSGGLDGSILYELTRPENTGAALTNSAADFQNSSSKYISHADIIAMGAVWGIASCGGPSIPYRGGRIDATGPGRTGVPEPQQDLASHTESFRLQGFTPTEMIGLVACGHTLGGVRSFDFPSIILDPTGLNISTFDSTTKYDHAIISEYLNSSTNNPLIRVANTSFASDLRIFGSDGNVTMKSLNSESAYFQTCTTLLARMLNTVPSDVTLTEEIELLPVKVWNAQITVVKSQLIFFTLLRLSHSTNVAPSVNRQVKLLWCDKRGQFKDCTKITNVASSQGGDFIPSTSPLTESQNITFSFYHFAFPISANRSVSKFWFQVDDGDGSAPVIHDNEGQGYVFQQDEIIYVPLLSHSNGPAGPNGFAQSFDFVVGIRSGNNVSRAQILGLDYTFQESGAIFNSTVDLQHNITGFLVEGYDYYSGQVNTTGSVLTVDMEVVVGDVSFAVDYLPALGMVGVEELLSSDQRSLINNITTTSSSAAPSPTTRSPSSAVLSLLPPPSIYPALLGIFVSLVCSLDH

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTGGTTCCTTTCATCGTCCTGTCCTCTGTCCTGACTGCTGCATTGGCCTATACATGGCCTTCACCACAATACGATGCTCTCGAAAAGTTTCTTTATGAAGGAACTGATGTCAAT
GGCAACTTTATCGCCTTCATCACTACACATTGTGTGCATAGAACCACTCCTGCCTCGGGACGGCACCCATCAACAGTTGCTGCAGAATGGCTTCGCCTG
GTATATTTTCTGTCCTGCTTA
AAACCATACCACAAATAACAACATGATATCAGGCGTACCATGACGCCGCGACACACAATGTCACGGATGGATCAGGGGGCTTAGATGGTTCAATACTGTACGAGCTCACCCGACCAGAGG
TGCGCCGACCTTGTCCACATGATTCACAACTAACAATCTCTGTCTAGAACACTGGTGCTGCATTAACTAATTCTGCGGCTGATTTCCAGAACTCATCAAGTAAATATATATCCCGTGAGT
CTGCCTTGGTCATTCGGCTGAGAACAGCCCACCTCATTTCCATGCTCAGACGCCGATATCATCGCAATGGGTGCGGTATGGGGTATCGCTTCTTGCGGTGGCCCTTCTATTCCCTACCGA
GGTGGCCGAATAGATGCAACAGGCCCGGGACGCACAGGCGTCCCAGAACCCCAGCAGGATCTAGCTTCTCATACGGAGAGTTTTCGACTGCAAGGATTCACCCCTACCGAAATGATTGGC
CTCGTCGCGTGCGGGCATACCCTTGGCGGTGTAAGGAGTTTCGATTTTCCTTCCATCATTTTGGACCCAACTGGATTGAATATTTCGACATTCGACTCCACGACTAAATACGATCACGCC
AT
GTATGTCTGATCCATCCTCGTGTTTCGGTATTCTAACCTTGACGTTGATTAAATTAGAATCAGCGAATATCTAAACTCGTCGACAAATAATCCATTGATCCGGGTCGCGAATACCTCA
TTCGCATCCGACCTCCGCATATTTGGCAGCGATGGAAATGTAACGATGAAAAG
GTAAAGTGATCATAGTCTTATGCGGGAGCACTCCATAACCTTAATTCTTGTCCTGTCTGGCATAGTC
TAAATTCGGAGAGTGCATACTTCCAAACGTGCACCACGTTGCTAGCGAGGATGCTAAATACTGTGCCTTCAGATGTAACACTGACGGAAGAAATTGAACTACTTCCGGTCAAGGTCTGGA
ACGCCCAAATCACAGTGGTTAAGTCACAACTTATCTTTTTTACTCTGTTACGA
GTAAGCCTTCGATACATTCCATATTTATTTTATTCATACTCTTTTTTCCAGCTCTCGCACTCAACTA
ACGTTGCACCTTCCGTAAATCGACAAGTAAAACTACTCTGGTGTGATAAACGTGGCCAATTCAAGGATTGTACCAAGATAACCAATGTCGCTTCGTCTCAAGGAGGAGATTTTATCCCTT
CAACATCTCCTTTGACCGAGTCCCAAAATATCACCTTCAGCTTCTACCATTTTGCTTTTCCCATCTCGGCCAACAGGTCGGTGTCGAAATTCTGGTTCCAGGTTGATGATGGTGATGGAT
CGGCCCCGGTCATCCACGACAACGAAGGGCAAGGATATGTGTTTCAACAGGACGAAATTATATATGTACCTTTACTCAGCCACAGTAACGGGCCAGCTGGCCCGAATGGATTCGCTCAGT
CCTTCGACTTTGTGGTGGGA
GTCAGTAAGCCCGTCCGTGTGATGCGGATTTTTTTTTGATCACTTTTTATGCGTAGATTCGGAGTGGGAACAATGTTTCTCGTGCTCAAATTCTTGGTCT
CGATTATACCTTTCAAGAAAGCGGAGCCATCTTCAACTCGACTGTTGATCTCCAACATAATATCACCGGCTTTCTCGTCGAAGGATATGACTATTACAGCGGTCAGGTCAACACAACTGG
TTCTGTGCTTACGGTGGATATGGAGGTCGTAGTTGGTGACGTTTCCTTTGCCGTCGACTACCTCCCGGCGTTGGGCATGGTCGGCGTAGAGGAGCTTCTCTCATCTGATCAACGGTCGCT
CATTAACAATATAACGACGACTTCATCTTCAGCTGCCCCAAGCCCTACTACGCGCTCGCCGTCTTCGGCTGTGCTCTCGCTGCTTCCTCCACCATCCATATATCCAGCCCTTCTGGGCAT
TTTCGTCTCGTTGGTTTGCTCCCTTGATCATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTGGTTCCTTTCATCGTCCTGTCCTCTGTCCTGACTGCTGCATTGGCCTATACATGGCCTTCACCACAATACGATGCTCTCGAAAAGTTTCTTTATGAAGGAACTGATGTCAAT
GGCAACTTTATCGCCTTCATCACTACACATTGTGTGCATAGAACCACTCCTGCCTCGGGACGGCACCCATCAACAGTTGCTGCAGAATGGCTTCGCCTG
GCGTACCATGACGCCGCGACA
CACAATGTCACGGATGGATCAGGGGGCTTAGATGGTTCAATACTGTACGAGCTCACCCGACCAGAG
AACACTGGTGCTGCATTAACTAATTCTGCGGCTGATTTCCAGAACTCATCAAGT
AAATATATATCCC
ACGCCGATATCATCGCAATGGGTGCGGTATGGGGTATCGCTTCTTGCGGTGGCCCTTCTATTCCCTACCGAGGTGGCCGAATAGATGCAACAGGCCCGGGACGCACA
GGCGTCCCAGAACCCCAGCAGGATCTAGCTTCTCATACGGAGAGTTTTCGACTGCAAGGATTCACCCCTACCGAAATGATTGGCCTCGTCGCGTGCGGGCATACCCTTGGCGGTGTAAGG
AGTTTCGATTTTCCTTCCATCATTTTGGACCCAACTGGATTGAATATTTCGACATTCGACTCCACGACTAAATACGATCACGCCAT
AATCAGCGAATATCTAAACTCGTCGACAAATAAT
CCATTGATCCGGGTCGCGAATACCTCATTCGCATCCGACCTCCGCATATTTGGCAGCGATGGAAATGTAACGATGAAAAG
TCTAAATTCGGAGAGTGCATACTTCCAAACGTGCACCACG
TTGCTAGCGAGGATGCTAAATACTGTGCCTTCAGATGTAACACTGACGGAAGAAATTGAACTACTTCCGGTCAAGGTCTGGAACGCCCAAATCACAGTGGTTAAGTCACAACTTATCTTT
TTTACTCTGTTACGA
CTCTCGCACTCAACTAACGTTGCACCTTCCGTAAATCGACAAGTAAAACTACTCTGGTGTGATAAACGTGGCCAATTCAAGGATTGTACCAAGATAACCAATGTC
GCTTCGTCTCAAGGAGGAGATTTTATCCCTTCAACATCTCCTTTGACCGAGTCCCAAAATATCACCTTCAGCTTCTACCATTTTGCTTTTCCCATCTCGGCCAACAGGTCGGTGTCGAAA
TTCTGGTTCCAGGTTGATGATGGTGATGGATCGGCCCCGGTCATCCACGACAACGAAGGGCAAGGATATGTGTTTCAACAGGACGAAATTATATATGTACCTTTACTCAGCCACAGTAAC
GGGCCAGCTGGCCCGAATGGATTCGCTCAGTCCTTCGACTTTGTGGTGGGA
ATTCGGAGTGGGAACAATGTTTCTCGTGCTCAAATTCTTGGTCTCGATTATACCTTTCAAGAAAGCGGA
GCCATCTTCAACTCGACTGTTGATCTCCAACATAATATCACCGGCTTTCTCGTCGAAGGATATGACTATTACAGCGGTCAGGTCAACACAACTGGTTCTGTGCTTACGGTGGATATGGAG
GTCGTAGTTGGTGACGTTTCCTTTGCCGTCGACTACCTCCCGGCGTTGGGCATGGTCGGCGTAGAGGAGCTTCTCTCATCTGATCAACGGTCGCTCATTAACAATATAACGACGACTTCA
TCTTCAGCTGCCCCAAGCCCTACTACGCGCTCGCCGTCTTCGGCTGTGCTCTCGCTGCTTCCTCCACCATCCATATATCCAGCCCTTCTGGGCATTTTCGTCTCGTTGGTTTGCTCCCTT
GATCATTGA

Retrieve as FASTA