Entry information : GmarAPx-CcP05
Entry ID 11913
Creation 2013-05-27 (Christophe Dunand)
Last sequence changes 2013-05-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-19 (Catherine Mathe (Scipio))
Peroxidase information: GmarAPx-CcP05
Name GmarAPx-CcP05
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarAPx-CcP05
start..stop
S start..stop
GmarAPx-CcP07 830 0 13..592 13..591
GmarAPx-CcP03 732 0 1..591 1..597
HcyAPx-CcP03 590 0 18..590 20..594
GmarAPx-CcP09 527 0 6..433 15..442
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 112668..112883 216 N° 2 112947..113033 87 N° 3 113086..113152 67 N° 4 113226..113538 313
N° 5 113598..113711 114 N° 6 113770..113944 175 N° 7 113997..114395 399 N° 8 114451..114873 423
join(112668..112883,112947..113033,113086..113152,113226..113538,113598..113711, 113770..113944,113997..114395,114451..114873)


exon

Literature and cross-references GmarAPx-CcP05
DNA ref. JGI genome:   scaffold_29 (112668..114873)
Cluster/Prediction ref. JGI gene:   102888
Protein sequence: GmarAPx-CcP05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   598 (579)
PWM (Da):   %s   63935.25 (62057.3)  
PI (pH):   %s   5.15 (5.15) Peptide Signal:   %s   cut: 19 range:19-597
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMLGSLVVASCILTSTSAYTWPSPQYDALEKFLYEGVDINGAPVGTITRGCTKRGNIGPQNQSTVAAEWLRLAYHDMATHNVTDGTGGLDASIFFELSRPEDIGSGMSNSLNDFQLSASKYVSRADVIAMGAVWAVASCNGPSIPFRGGRRDAIGPGRLGVPEPQQDIASHTESFRLQGFTQTEMISLVACGHTLGGVRSADFPNIVVDKTGLNISTFDTTVSFDTAVVSEYLDSTTTNPLVRVANITLASDQRIFNSDGNVTIKGLNSQSAFFQTCTKLLARMLDTVPSNVTLTDEIELLQAKVSSARITVFKSQLLFDTTLRLSQPTTSNASTPTNRQVKLFWCDKRGQLKDCANTTNVASSPANPSVEVSPLTESQKTTFIAYQFSVPILANRSVSKFWFQVDEGDGSAPIIHDNAGHGYILPQDEIIYALSIGDRTADLQAGKLTQIFTLGAGIRSGSNLTRAQIHASDYSFRGSGTLVNTTVDLRRNTTQFLADGYDAYTARVETTGNALHMDLEVIIDGVSYVDDYISAENLIDQPGPLSSVTNMTTTSTSAAPGNTAHTASSALLIHPPPLVHLAILAILSSLLSLRSLL

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCTCGGCTCGCTGGTCGTCGCATCATGCATTCTGACTAGCACATCGGCTTATACATGGCCTTCTCCGCAATATGACGCCCTCGAAAAGTTCCTATATGAAGGTGTCGATATCAAC
GGTGCGCCAGTCGGCACGATCACCCGAGGTTGCACCAAGAGAGGGAACATTGGGCCACAAAATCAATCAACAGTGGCAGCGGAATGGCTTCGCCTG
GTACGTTTTCTGACTCTTTATTTT
TTCGTAAAAATATTTAGATTTCTGACCAAGAAATGGTAGGCGTACCACGATATGGCAACTCATAATGTTACTGATGGAACAGGCGGACTTGACGCTTCGATATTCTTCGAACTGAGCCGA
CCAGAG
GTCCGCAAGTCTCATAATTCTTATTTTTTTTCTGGCTAATACCCTTGCCTAGGACATCGGCTCTGGTATGTCCAATTCCCTTAACGATTTCCAATTATCGGCGAGTAAATATGT
CTCCC
GTAAGCCAACGTTTGTCAAGGCCGACCCATTGGTCGATATCTAGAACTGACGCATTTTGATTCGTCTTTAAAGGTGCTGATGTGATCGCCATGGGCGCTGTATGGGCTGTCGCCT
CATGCAATGGTCCCTCTATTCCTTTCCGAGGCGGGAGACGAGATGCCATTGGTCCTGGGCGTCTAGGCGTTCCAGAACCCCAACAAGACATAGCTTCTCATACGGAGAGCTTTCGTCTGC
AAGGGTTTACGCAAACCGAGATGATCAGCCTTGTTGCCTGCGGCCATACTCTTGGTGGTGTTCGTAGCGCCGATTTTCCTAACATCGTGGTGGACAAAACCGGATTGAATATTTCAACTT
TCGACACCACAGTTTCCTTTGACACTGCTGT
GTGAGCTTGGTTGTTTCTTATTCAGCGATACCTTACTTATTCTGGACGAACAAAATTAGAGTGAGCGAATACTTAGATTCTACAACGAC
GAATCCCTTGGTCCGGGTTGCCAATATTACGCTCGCGTCGGACCAGAGGATATTCAACAGCGATGGAAATGTCACCATCAAGGG
GCAAGTCGTTCTTTATCTCCGAGACCAGCCATCTGC
TTATTTTAAACTCTCCGCGTAGTTTGAACTCCCAAAGTGCTTTCTTCCAAACCTGCACAAAATTGTTAGCAAGGATGCTTGACACCGTCCCTTCCAACGTGACTTTAACGGACGAAATTG
AGCTACTTCAGGCCAAAGTCTCAAGCGCTCGAATTACGGTGTTCAAGTCCCAACTTCTCTTCGATACCACACTTCGC
GTACGTTTATTTTACTTTCGTAGTTCATCAAGTTTTATATTAA
TGCCTTTAGCTATCGCAACCGACTACTAGTAACGCCTCGACTCCCACAAATCGACAAGTGAAACTATTCTGGTGCGACAAACGTGGGCAATTGAAGGATTGTGCCAACACAACGAACGTC
GCGTCATCTCCAGCCAATCCATCCGTAGAGGTGTCTCCCTTGACAGAGTCGCAGAAAACGACCTTCATCGCCTATCAATTTTCTGTTCCCATCCTTGCAAACCGGTCCGTTTCTAAATTC
TGGTTCCAAGTCGATGAAGGTGATGGGTCGGCTCCGATTATCCATGATAACGCTGGGCACGGGTATATATTACCACAAGACGAGATTATATACGCGCTTTCGATTGGCGACCGGACTGCA
GATCTACAGGCGGGTAAGCTGACCCAAATCTTCACCCTCGGTGCAGGT
GTGAGTAAATGCAACTTCGCTCATCGCTCTTGCCTCTGACCGCTTTCAATGATAGATTCGAAGCGGGAGTAA
TCTTACTCGTGCTCAAATCCATGCATCCGACTATTCATTCCGCGGAAGCGGAACTCTCGTCAACACGACCGTCGACCTTCGGCGCAATACCACGCAATTCCTTGCGGACGGATACGATGC
TTACACCGCCCGCGTAGAAACGACTGGAAATGCGCTTCATATGGATTTGGAGGTTATTATTGACGGTGTTTCATATGTCGATGACTACATCTCTGCTGAAAACCTCATCGACCAGCCTGG
GCCTTTATCGAGCGTTACGAATATGACGACAACTTCAACGTCTGCTGCTCCAGGCAATACTGCTCACACAGCGTCTTCCGCACTACTGATACATCCACCTCCGCTGGTTCACTTGGCCAT
TTTGGCTATTCTCAGTTCGTTACTTTCTTTGCGTTCGCTTTTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCTCGGCTCGCTGGTCGTCGCATCATGCATTCTGACTAGCACATCGGCTTATACATGGCCTTCTCCGCAATATGACGCCCTCGAAAAGTTCCTATATGAAGGTGTCGATATCAAC
GGTGCGCCAGTCGGCACGATCACCCGAGGTTGCACCAAGAGAGGGAACATTGGGCCACAAAATCAATCAACAGTGGCAGCGGAATGGCTTCGCCTG
GCGTACCACGATATGGCAACTCAT
AATGTTACTGATGGAACAGGCGGACTTGACGCTTCGATATTCTTCGAACTGAGCCGACCAGAG
GACATCGGCTCTGGTATGTCCAATTCCCTTAACGATTTCCAATTATCGGCGAGTAAA
TATGTCTCCC
GTGCTGATGTGATCGCCATGGGCGCTGTATGGGCTGTCGCCTCATGCAATGGTCCCTCTATTCCTTTCCGAGGCGGGAGACGAGATGCCATTGGTCCTGGGCGTCTAGGC
GTTCCAGAACCCCAACAAGACATAGCTTCTCATACGGAGAGCTTTCGTCTGCAAGGGTTTACGCAAACCGAGATGATCAGCCTTGTTGCCTGCGGCCATACTCTTGGTGGTGTTCGTAGC
GCCGATTTTCCTAACATCGTGGTGGACAAAACCGGATTGAATATTTCAACTTTCGACACCACAGTTTCCTTTGACACTGCTGT
AGTGAGCGAATACTTAGATTCTACAACGACGAATCCC
TTGGTCCGGGTTGCCAATATTACGCTCGCGTCGGACCAGAGGATATTCAACAGCGATGGAAATGTCACCATCAAGGG
TTTGAACTCCCAAAGTGCTTTCTTCCAAACCTGCACAAAATTG
TTAGCAAGGATGCTTGACACCGTCCCTTCCAACGTGACTTTAACGGACGAAATTGAGCTACTTCAGGCCAAAGTCTCAAGCGCTCGAATTACGGTGTTCAAGTCCCAACTTCTCTTCGAT
ACCACACTTCGC
CTATCGCAACCGACTACTAGTAACGCCTCGACTCCCACAAATCGACAAGTGAAACTATTCTGGTGCGACAAACGTGGGCAATTGAAGGATTGTGCCAACACAACGAAC
GTCGCGTCATCTCCAGCCAATCCATCCGTAGAGGTGTCTCCCTTGACAGAGTCGCAGAAAACGACCTTCATCGCCTATCAATTTTCTGTTCCCATCCTTGCAAACCGGTCCGTTTCTAAA
TTCTGGTTCCAAGTCGATGAAGGTGATGGGTCGGCTCCGATTATCCATGATAACGCTGGGCACGGGTATATATTACCACAAGACGAGATTATATACGCGCTTTCGATTGGCGACCGGACT
GCAGATCTACAGGCGGGTAAGCTGACCCAAATCTTCACCCTCGGTGCAGGT
ATTCGAAGCGGGAGTAATCTTACTCGTGCTCAAATCCATGCATCCGACTATTCATTCCGCGGAAGCGGA
ACTCTCGTCAACACGACCGTCGACCTTCGGCGCAATACCACGCAATTCCTTGCGGACGGATACGATGCTTACACCGCCCGCGTAGAAACGACTGGAAATGCGCTTCATATGGATTTGGAG
GTTATTATTGACGGTGTTTCATATGTCGATGACTACATCTCTGCTGAAAACCTCATCGACCAGCCTGGGCCTTTATCGAGCGTTACGAATATGACGACAACTTCAACGTCTGCTGCTCCA
GGCAATACTGCTCACACAGCGTCTTCCGCACTACTGATACATCCACCTCCGCTGGTTCACTTGGCCATTTTGGCTATTCTCAGTTCGTTACTTTCTTTGCGTTCGCTTTTGTAG

Retrieve as FASTA