Entry information : GmarAPx-CcP07
Entry ID 11915
Creation 2013-05-27 (Christophe Dunand)
Last sequence changes 2013-05-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-19 (Catherine Mathe (Scipio))
Peroxidase information: GmarAPx-CcP07
Name GmarAPx-CcP07
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarAPx-CcP07
start..stop
S start..stop
GmarAPx-CcP05 833 0 1..578 1..580
GmarAPx-CcP03 712 0 1..575 1..581
HcyAPx-CcP03 582 0 16..539 18..542
GmarAPx-CcP09 519 0 3..460 9..469
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 305246..305458 213 N° 2 305097..305183 87 N° 3 304977..305043 67 N° 4 304589..304913 325
N° 5 304421..304528 108 N° 6 304183..304357 175 N° 7 303737..304129 393 N° 8 303278..303685 408
complement(join(303278..303685,303737..304129,304183..304357,304421..304528,3045 89..304913,304977..305043,305097..305183,305246..305458))


exon

Literature and cross-references GmarAPx-CcP07
DNA ref. JGI genome:   scaffold_49 (305458..303278)
Cluster/Prediction ref. JGI gene:   79879
Protein sequence: GmarAPx-CcP07
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   592 (573)
PWM (Da):   %s   63409.85 (61441.8)  
PI (pH):   %s   4.98 (4.98) Peptide Signal:   %s   cut: 19 range:19-591
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVLSSFVVVSSFIITISAYTWPSPQYDALEKLLYEGSDISGVPIASITRGCATRGQPAEQKSTVAAEWLRLAYHDMATHNITDGTGGLDASIFFELNRPENIGAGMSDSVGDFQFSATKYISRADIIAMGAVWAVASCKGPSIPYRGGRIDAKGSGRLGVPEPQQDLASHTESFRLQGFLSTEMISLVACGHTLGGVRSLHFPNIVEDKRGNVLSTSTFDTTDAFDSAVLVEYLDSSTMNPLIRVVNTTLASDLRIFSSDGNVTMKSLNSESAFLQACTTLLEKMINTVPSNVTLTDEIKLLPAKVTDAQITVCNSQLIFQTMLRLSHLNTVSTPKNRKVKLFWCDKRGQFKDCASITNVASAPESPPVEVSPLTESQSTTFIAYKFSVPMSANRSVAKFWFQVDEGDGSTPTIHDNDGRGYILPQDEIIHASSIGTIISDFTGDQLNHSFIFDAGIRSESNFTRAQIHASDYSSRGSGPLLNTTIELQRNATKTFVEGYDLYTAHVATAGGGLNVDMEVIINGVSYAVDYISAATIDQLGPLSTITNITTSSISTAPGTNTSSPSSAVPMHLLPLVYLAASAVLLTSLLS

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTCTCAGTTCATTCGTGGTTGTATCTTCCTTCATAATCACCATATCAGCCTATACATGGCCTTCGCCGCAATATGACGCTCTCGAGAAGCTCCTATACGAAGGTTCAGATATTAGC
GGAGTGCCAATTGCTAGCATCACCAGAGGTTGTGCGACGAGAGGACAGCCCGCAGAACAAAAATCAACGGTAGCTGCGGAATGGCTTCGTTTG
GTATGCTTTCCATGGCCTTTTCTTCTT
ATCGTATTCAAAGTTCTGATGAGATATGAGATTAGGCGTACCACGATATGGCCACTCATAATATCACTGATGGAACAGGTGGGCTTGATGCCTCAATATTCTTTGAACTGAACCGACCGG
AG
GTTCGTAACTCTCGCTCCCTCAATAATGTTTAACTAATCAATACTCTACTTAGAACATTGGTGCTGGCATGTCCGACTCCGTAGGGGACTTTCAATTTTCGGCTACCAAATACATATC
CC
GTTCGTCAATGTCGACCTCTCTAATCGATACATGGAACTGACCAACAGCGTTCTCATTTTAAGGTGCTGATATAATTGCCATGGGTGCTGTATGGGCCGTCGCATCGTGTAAAGGCCC
CTCCATTCCCTACAGAGGCGGGAGAATAGATGCGAAAGGCTCCGGACGCCTAGGTGTTCCTGAGCCGCAGCAGGATTTAGCCTCTCACACGGAAAGCTTTCGTCTTCAGGGATTTTTGTC
AACCGAGATGATCAGCCTCGTCGCATGCGGCCACACCCTTGGGGGCGTACGAAGTCTTCATTTCCCTAATATCGTTGAGGATAAACGAGGAAATGTGCTTTCGACCTCGACCTTTGATAC
CACGGATGCTTTTGATTCTGCTGTGTTAGT
GTTGATTCTCCTTTTTGTTATGGTGTCATATTGACCCTAGATTCTCAAAATTAGAGTAAGCGAATATTTGGATTCTTCGACGATGAACCC
CCTGATCCGGGTTGTTAATACCACGCTCGCATCAGACCTGCGCATATTCAGTAGCGACGGAAATGTGACCATGAAAAG
GTGTGTCATTTACGTTCTCCTTGGGAAGCAGTTCCTTACCAT
AGTCTCTATTTAATCGCGTAGCCTAAACTCTGAAAGCGCTTTCCTCCAGGCATGCACAACCTTATTAGAAAAGATGATTAATACCGTTCCTTCCAACGTAACCTTGACAGATGAAATTAA
ATTACTCCCAGCGAAAGTTACAGACGCTCAAATCACCGTTTGTAACTCCCAATTAATCTTTCAAACTATGCTGCGT
GTACGTCCCTCTTCATTGTTATATTCCACTGACTTAGACCTTAC
TCTCTCCAGCTATCTCATCTAAATACAGTCTCTACGCCAAAAAATCGAAAAGTCAAATTATTTTGGTGTGATAAACGCGGGCAATTCAAAGATTGTGCTAGCATAACCAACGTTGCGTCA
GCCCCGGAAAGTCCGCCTGTGGAGGTATCACCCTTGACAGAGTCACAGAGTACGACTTTCATTGCATACAAATTTTCCGTCCCCATGTCTGCAAACCGATCCGTTGCGAAATTCTGGTTC
CAGGTCGACGAAGGCGATGGTTCGACTCCAACTATTCATGATAACGATGGGCGCGGGTATATACTACCCCAAGACGAAATTATACACGCATCATCAATTGGTACAATTATCTCGGATTTC
ACAGGCGATCAGCTGAATCACAGCTTCATCTTCGATGCAGGT
GTAAGTAAACCCATCTCTGGTTGTCGTATTACCTCTAACCATTATTGATAGATACGAAGTGAAAGCAATTTTACTCGT
GCCCAGATCCACGCGTCTGACTACTCGTCCAGGGGAAGTGGCCCTCTCCTTAATACGACAATCGAGCTCCAGCGCAATGCCACCAAAACGTTTGTGGAAGGATATGACCTATACACAGCT
CACGTTGCAACGGCCGGAGGTGGGCTTAACGTGGATATGGAGGTTATCATAAACGGTGTTTCGTATGCAGTGGACTACATCTCTGCTGCAACAATCGACCAGCTTGGGCCGCTTTCGACC
ATCACGAACATTACGACGTCTTCAATATCTACGGCGCCGGGCACTAATACAAGTTCGCCGTCCTCGGCTGTACCGATGCATTTATTGCCACTGGTCTATCTTGCTGCTTCGGCTGTTCTT
CTCACTTCGTTGCTTTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTCTCAGTTCATTCGTGGTTGTATCTTCCTTCATAATCACCATATCAGCCTATACATGGCCTTCGCCGCAATATGACGCTCTCGAGAAGCTCCTATACGAAGGTTCAGATATTAGC
GGAGTGCCAATTGCTAGCATCACCAGAGGTTGTGCGACGAGAGGACAGCCCGCAGAACAAAAATCAACGGTAGCTGCGGAATGGCTTCGTTTG
GCGTACCACGATATGGCCACTCATAAT
ATCACTGATGGAACAGGTGGGCTTGATGCCTCAATATTCTTTGAACTGAACCGACCGGAG
AACATTGGTGCTGGCATGTCCGACTCCGTAGGGGACTTTCAATTTTCGGCTACCAAATAC
ATATCCC
GTGCTGATATAATTGCCATGGGTGCTGTATGGGCCGTCGCATCGTGTAAAGGCCCCTCCATTCCCTACAGAGGCGGGAGAATAGATGCGAAAGGCTCCGGACGCCTAGGTGTT
CCTGAGCCGCAGCAGGATTTAGCCTCTCACACGGAAAGCTTTCGTCTTCAGGGATTTTTGTCAACCGAGATGATCAGCCTCGTCGCATGCGGCCACACCCTTGGGGGCGTACGAAGTCTT
CATTTCCCTAATATCGTTGAGGATAAACGAGGAAATGTGCTTTCGACCTCGACCTTTGATACCACGGATGCTTTTGATTCTGCTGTGTTAGT
CGAATATTTGGATTCTTCGACGATGAAC
CCCCTGATCCGGGTTGTTAATACCACGCTCGCATCAGACCTGCGCATATTCAGTAGCGACGGAAATGTGACCATGAAAAG
CCTAAACTCTGAAAGCGCTTTCCTCCAGGCATGCACAACC
TTATTAGAAAAGATGATTAATACCGTTCCTTCCAACGTAACCTTGACAGATGAAATTAAATTACTCCCAGCGAAAGTTACAGACGCTCAAATCACCGTTTGTAACTCCCAATTAATCTTT
CAAACTATGCTGCGT
CTATCTCATCTAAATACAGTCTCTACGCCAAAAAATCGAAAAGTCAAATTATTTTGGTGTGATAAACGCGGGCAATTCAAAGATTGTGCTAGCATAACCAACGTT
GCGTCAGCCCCGGAAAGTCCGCCTGTGGAGGTATCACCCTTGACAGAGTCACAGAGTACGACTTTCATTGCATACAAATTTTCCGTCCCCATGTCTGCAAACCGATCCGTTGCGAAATTC
TGGTTCCAGGTCGACGAAGGCGATGGTTCGACTCCAACTATTCATGATAACGATGGGCGCGGGTATATACTACCCCAAGACGAAATTATACACGCATCATCAATTGGTACAATTATCTCG
GATTTCACAGGCGATCAGCTGAATCACAGCTTCATCTTCGATGCAGGT
ATACGAAGTGAAAGCAATTTTACTCGTGCCCAGATCCACGCGTCTGACTACTCGTCCAGGGGAAGTGGCCCT
CTCCTTAATACGACAATCGAGCTCCAGCGCAATGCCACCAAAACGTTTGTGGAAGGATATGACCTATACACAGCTCACGTTGCAACGGCCGGAGGTGGGCTTAACGTGGATATGGAGGTT
ATCATAAACGGTGTTTCGTATGCAGTGGACTACATCTCTGCTGCAACAATCGACCAGCTTGGGCCGCTTTCGACCATCACGAACATTACGACGTCTTCAATATCTACGGCGCCGGGCACT
AATACAAGTTCGCCGTCCTCGGCTGTACCGATGCATTTATTGCCACTGGTCTATCTTGCTGCTTCGGCTGTTCTTCTCACTTCGTTGCTTTCTTAA

Retrieve as FASTA