Entry information : GmarAPx-CcP09
Entry ID 11918
Creation 2013-05-27 (Christophe Dunand)
Last sequence changes 2013-05-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-19 (Catherine Mathe (Scipio))
Peroxidase information: GmarAPx-CcP09
Name GmarAPx-CcP09
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarAPx-CcP09
start..stop
S start..stop
GmarAPx-CcP03 530 0 9..465 3..459
GmarAPx-CcP05 526 0 15..442 6..433
GmarAPx-CcP07 517 2e-180 25..469 16..460
GmarAPx-CcP02 498 2e-174 1..445 1..438
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 427520..427753 234 N° 2 427360..427446 87 N° 3 427240..427306 67 N° 4 426867..427179 313
N° 5 426681..426794 114 N° 6 426429..426618 190 N° 7 425981..426364 384 N° 8 425834..425914 81
complement(join(425834..425914,425981..426364,426429..426618,426681..426794,4268 67..427179,427240..427306,427360..427446,427520..427753))


exon

Literature and cross-references GmarAPx-CcP09
DNA ref. JGI genome:   scaffold_30 (427753..425834)
Cluster/Prediction ref. JGI gene:   880845
Protein sequence: GmarAPx-CcP09
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   490 (466)
PWM (Da):   %s   52552.29 (50000.9)  
PI (pH):   %s   6.16 (5.09) Peptide Signal:   %s   cut: 24 range:24-489
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSSRRIGLRAFLVLSSSSTVFGAVSNYMWPSPQFDAIERFLYEGTNVFGSAISALADNCQKRQGPPSSTVAAEWLRMTYHDVATHNISDGTGGLDASIFFELDRAENIGAGNKNSVGDFRNAASKYVSRSDLIAMAAVWGVAACGGPQVAYRYGRQDAMAAGRLGVPLPQDDLASHTEAFRLQGFTPAEMIGLVACGHTLGGVRAVDFPNIVVDPANATIATFDTTPAFDSSIVSEYLDSSTKDPLIRATNTNLTSDQRIFGSDNNATMNALNSAGAYFSTCSTLLARMIDTVPSSVQLSSEVNVLPAKVYSAQITVMLDSDSTKQLAFTSTLLTQNNTTIPPNRQVKLLWCDRQGDFKDCNKITNVATSPPELISSAQLSPLSRSLKLKFPTYAFQVPLSANRSVSKFWFEVDEGDGSPATTYDNGGAGYLLDDALIFAPYLSQLTFPGNQMKSQNLVVGKRLRGEPIIGVYSCSRLLRIGPDTGA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCCTCCCGACGCATCGGTCTACGCGCTTTCCTTGTCCTTTCCTCTTCTTCTACGGTTTTCGGGGCGGTCAGTAACTATATGTGGCCATCTCCTCAATTCGATGCCATAGAGAGG
TTCCTCTATGAAGGAACGAACGTGTTCGGGTCAGCAATAAGCGCCTTGGCGGATAATTGTCAGAAAAGACAAGGGCCCCCCTCCTCCACCGTTGCCGCTGAATGGCTACGCATG
GTTAGA
GAAAATTTCATTGCCCTTGGTCCGGTGTGCACGCCAAAGCTAACTATGAATTGGCGTAACTCTGTAGACTTATCATGATGTCGCAACACATAATATTTCGGATGGAACGGGCGGCCTTGA
CGCATCTATTTTCTTCGAACTTGACAGGGCGGAG
GTGAGCATTCAGGTGTTTAATAAAGGGGATAAAATTACTTATCGACTTTGGAGAACATCGGTGCTGGGAATAAAAACTCGGTGGGC
GATTTCAGGAATGCTGCAAGCAAATATGTATCTC
GTAAGTTCAAACCCGAGTTGTTAATCCCCGTATCACCTATAATTATTCTCCAAATTCAAGGTTCAGACCTAATCGCTATGGCGGCG
GTATGGGGGGTGGCCGCATGCGGCGGCCCCCAAGTAGCATATCGATACGGGAGACAAGACGCAATGGCGGCTGGCCGGCTAGGAGTTCCGTTGCCGCAGGACGACCTGGCATCCCACACC
GAAGCCTTTCGTCTTCAAGGGTTCACTCCAGCAGAGATGATAGGCCTCGTTGCGTGCGGACATACATTAGGTGGAGTAAGAGCCGTGGACTTCCCAAATATTGTGGTCGATCCGGCCAAT
GCCACCATCGCAACTTTCGACACTACTCCTGCGTTCGATTCCAGCAT
GTAAGTCTGTCGTCCCCCTTGTTGCGTGTCATAGACTAATACGGGACGATTGGGCGGTTTCCCTTCCTTTAGA
GTCAGCGAGTATCTGGACTCATCGACCAAGGACCCATTAATTAGAGCTACAAACACTAATCTGACATCTGATCAGCGGATTTTTGGTAGCGACAATAATGCTACCATGAACGC
GTATGTC
ATTTGTTTTCCATGAAGCTCGCCCTTGCCTATGTGATTTACGATGCTCCTTACAGGCTTAATTCGGCTGGGGCGTACTTCAGCACATGTTCGACGCTGCTCGCGCGAATGATAGATACTG
TTCCTTCCAGCGTGCAGCTCAGCTCCGAGGTCAACGTCTTACCCGCCAAGGTGTACAGTGCCCAGATTACGGTAATGCTCGACTCGGACTCAACAAAGCAGCTCGCTTTTACGTCAACTC
TCAGA
GTGCGTTTTTACCCTCAACTTTGAAGGAGTCAAACCTTGCGACTGAACTTTTCTCTTTCTATAGTTGACCCAAAATAATACTACTATTCCCCCGAATCGCCAGGTCAAGTTGTTA
TGGTGTGACCGCCAGGGAGATTTTAAAGACTGCAACAAAATCACGAATGTCGCAACTTCCCCTCCAGAGCTCATCTCTTCCGCCCAACTATCACCTCTGAGCAGATCGTTGAAGCTTAAA
TTCCCAACATATGCTTTCCAAGTCCCTCTTTCTGCGAATAGATCGGTTTCAAAGTTCTGGTTTGAGGTCGATGAAGGAGATGGATCGCCGGCGACAACTTATGATAACGGAGGAGCGGGA
TACCTATTGGACGATGCCTTAATTTTTGCCCCATATCTATCACAGTTGACATTCCCAGGAAATCAAATGAAGTCCCAAAATCTGGTAGTCGGG
GTACGTACCATTCCTGGCTTGATAACC
TTTGTCAATTTACCGATCTTGCTACTTGGCGTAGATAAGAAGCGACTTAGAGGGGAGCCTATCATCGGCGTCTATTCGTGCTCAAGACTTCTCAGGATTGGGCCAGATACCGGCGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCCTCCCGACGCATCGGTCTACGCGCTTTCCTTGTCCTTTCCTCTTCTTCTACGGTTTTCGGGGCGGTCAGTAACTATATGTGGCCATCTCCTCAATTCGATGCCATAGAGAGG
TTCCTCTATGAAGGAACGAACGTGTTCGGGTCAGCAATAAGCGCCTTGGCGGATAATTGTCAGAAAAGACAAGGGCCCCCCTCCTCCACCGTTGCCGCTGAATGGCTACGCATG
ACTTAT
CATGATGTCGCAACACATAATATTTCGGATGGAACGGGCGGCCTTGACGCATCTATTTTCTTCGAACTTGACAGGGCGGAG
AACATCGGTGCTGGGAATAAAAACTCGGTGGGCGATTTC
AGGAATGCTGCAAGCAAATATGTATCTC
GTTCAGACCTAATCGCTATGGCGGCGGTATGGGGGGTGGCCGCATGCGGCGGCCCCCAAGTAGCATATCGATACGGGAGACAAGACGCAATG
GCGGCTGGCCGGCTAGGAGTTCCGTTGCCGCAGGACGACCTGGCATCCCACACCGAAGCCTTTCGTCTTCAAGGGTTCACTCCAGCAGAGATGATAGGCCTCGTTGCGTGCGGACATACA
TTAGGTGGAGTAAGAGCCGTGGACTTCCCAAATATTGTGGTCGATCCGGCCAATGCCACCATCGCAACTTTCGACACTACTCCTGCGTTCGATTCCAGCAT
AGTCAGCGAGTATCTGGAC
TCATCGACCAAGGACCCATTAATTAGAGCTACAAACACTAATCTGACATCTGATCAGCGGATTTTTGGTAGCGACAATAATGCTACCATGAACGC
GCTTAATTCGGCTGGGGCGTACTTC
AGCACATGTTCGACGCTGCTCGCGCGAATGATAGATACTGTTCCTTCCAGCGTGCAGCTCAGCTCCGAGGTCAACGTCTTACCCGCCAAGGTGTACAGTGCCCAGATTACGGTAATGCTC
GACTCGGACTCAACAAAGCAGCTCGCTTTTACGTCAACTCTCAGA
TTGACCCAAAATAATACTACTATTCCCCCGAATCGCCAGGTCAAGTTGTTATGGTGTGACCGCCAGGGAGATTTT
AAAGACTGCAACAAAATCACGAATGTCGCAACTTCCCCTCCAGAGCTCATCTCTTCCGCCCAACTATCACCTCTGAGCAGATCGTTGAAGCTTAAATTCCCAACATATGCTTTCCAAGTC
CCTCTTTCTGCGAATAGATCGGTTTCAAAGTTCTGGTTTGAGGTCGATGAAGGAGATGGATCGCCGGCGACAACTTATGATAACGGAGGAGCGGGATACCTATTGGACGATGCCTTAATT
TTTGCCCCATATCTATCACAGTTGACATTCCCAGGAAATCAAATGAAGTCCCAAAATCTGGTAGTCGGG
AAGCGACTTAGAGGGGAGCCTATCATCGGCGTCTATTCGTGCTCAAGACTT
CTCAGGATTGGGCCAGATACCGGCGCCTAA

Retrieve as FASTA