Entry information : GmarAPx-CcP10
Entry ID 11919
Creation 2013-05-27 (Christophe Dunand)
Last sequence changes 2013-05-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-19 (Catherine Mathe (Scipio))
Peroxidase information: GmarAPx-CcP10
Name GmarAPx-CcP10
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarAPx-CcP10
start..stop
S start..stop
HsubAPx-CcP02 864 0 9..563 6..559
HcyAPx-CcP02 864 0 20..608 21..610
LameAPx-CcP01 777 0 1..575 1..566
LbiAPx-CcP 775 0 1..575 1..574
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 537483..537698 216 N° 2 537758..537844 87 N° 3 537899..537965 67 N° 4 538031..538355 325
N° 5 538415..538528 114 N° 6 538578..538752 175 N° 7 538808..539647 840  
join(537483..537698,537758..537844,537899..537965,538031..538355,538415..538528, 538578..538752,538808..539647)


exon

Literature and cross-references GmarAPx-CcP10
DNA ref. JGI genome:   scaffold_19 (537483..539647)
Cluster/Prediction ref. JGI gene:   251405
Protein sequence: GmarAPx-CcP10
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   609 (586)
PWM (Da):   %s   66478.91 (63973.5)  
PI (pH):   %s   4.79 (4.72) Peptide Signal:   %s   cut: 23 range:23-608
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRGLPLVFSLYLLSLVTPFSSAYTWPSPQYDTLEALLYEGRRSDGSSLSSLVHPCRKRTGTLASVPAEWLRFAFHDMATHNVDNGMGGLDGSIAYELDRAENFGLGFNQTLSDFEAYPNKLVSRADIFAIGAIMAVNTCGGPILPFRGGRIDAWSAGGTGTPEPQQDLPTLTESFRKQGYSQSEMIKLVACGHTMGGVRSADFPQLVAPDPNSIYPVIKNFDTTTEKFDNAVVTEYLNGSTQNLLVVSANQTMDSDLRVFQSDNNSTIRSMADNTVFQSECQSILTRMIDTVPASVTLTDEITLLPAKVTYAQLTFEKNQFIFKTNFRLTQAINATANANRNVTLFWCDRYGDNQNCAHKTSTALPVNKVADDPGVSPVTQTLGYYFLNYNFVIPINTNTSIAKFWFEVDEHDGSKVTTYNNGGSNYVIDQDQVLFVPMSSHMSIVPNTTATQTYTNRVGDGNTRHYSLVIAVRDGTNPSRVYVDGTDVAVQGFPFPVNLQVDFTLNSSIPALAGYSFYTGTADSAGVQLSMDVHAVTSSQTYTQTFQQTLLLDNTPYVKPGTTTTTASKSAAGRMAVPLMGIDLWNTLLVLPGVFFYLNGNLLDLV

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGGGCTTCCTTTAGTCTTCTCTCTCTATCTTTTATCTCTCGTTACCCCCTTTTCTTCTGCCTACACATGGCCTTCGCCACAATATGATACTCTTGAAGCCCTTTTGTATGAAGGT
CGCCGCTCCGATGGCTCCAGCCTCTCTTCTCTCGTCCATCCATGTCGGAAACGAACGGGAACTCTCGCCTCAGTTCCTGCTGAATGGCTTCGTTTT
GTGCGTAATCGATTTGTTTCTGGC
CATATTCTCTGTTTTGAATGTTGGATACACTACAGGCTTTTCACGACATGGCAACCCATAACGTTGACAATGGCATGGGTGGATTGGATGGTTCAATTGCGTACGAACTTGACCGTGCGG
AG
GTGTGTTATTAAAAATAAGACTGTGCAAGGGCTGGAATGACCGCTTTCTTCCAGAACTTTGGTCTCGGCTTCAACCAGACCTTAAGTGACTTCGAGGCCTATCCTAATAAACTAGTCT
CCA
GTGCGTTTCCTTCCGCCAGTAGTCTAGGTCCTTAACTCAATAGTGACCATTCCTTCGTGGTTCAGGAGCCGATATCTTTGCCATAGGCGCCATCATGGCTGTAAACACGTGCGGCGG
GCCCATTCTTCCATTTCGTGGCGGCCGTATCGATGCTTGGTCGGCTGGTGGTACCGGCACGCCTGAGCCCCAGCAAGACCTTCCGACTCTTACAGAGAGCTTCAGAAAGCAGGGGTACAG
TCAAAGCGAGATGATCAAACTCGTTGCCTGCGGCCATACTATGGGTGGTGTCAGGAGCGCCGACTTTCCCCAGCTCGTTGCGCCTGACCCCAACTCTATTTATCCAGTTATCAAGAACTT
TGACACCACTACCGAAAAATTTGATAATGCTGT
GTAACCTTCGGTTTACTTCTCTTCATACGACGTCGTATTGACTTTTTTTTCGCTCTCAGTGTCACAGAATATCTCAATGGATCTACG
CAAAATCTCCTCGTTGTTAGCGCGAACCAAACCATGGACTCTGATCTCCGCGTATTTCAGAGTGATAATAACAGCACGATTCGGAG
GTCAGTGACAACACTGTTTTATCTCGGTTGCCCT
TATATTGTTTATTAGTATGGCAGATAACACAGTCTTTCAGTCAGAGTGTCAGAGTATTCTGACACGTATGATTGACACTGTACCGGCATCTGTAACCCTGACGGACGAAATTACTCTTCT
GCCTGCCAAAGTCACTTACGCACAACTCACATTTGAGAAAAATCAGTTTATCTTCAAGACAAATTTCCGC
GTATGTTCCTTTCCTCTACTGTGTTATTGCGATTCAATCTAATCAATCGA
TATAGTTGACGCAAGCTATCAATGCCACAGCAAACGCTAATCGCAATGTCACCTTGTTCTGGTGTGACAGATATGGCGATAACCAAAACTGTGCTCACAAGACCAGCACTGCGTTGCCCG
TCAACAAGGTTGCAGATGACCCAGGCGTGTCGCCAGTTACCCAAACTCTCGGGTACTACTTCTTGAACTACAATTTTGTCATTCCTATCAACACCAATACCTCAATTGCTAAATTTTGGT
TTGAGGTGGACGAACATGATGGAAGCAAGGTGACAACCTACAATAACGGTGGCAGCAACTACGTTATCGATCAGGATCAGGTCCTCTTCGTCCCTATGTCTAGTCACATGTCTATTGTCC
CCAACACTACTGCTACCCAAACCTACACGAACAGAGTTGGTGACGGCAACACTCGTCATTATTCTCTCGTCATCGCCGTGCGGGATGGCACGAACCCCTCACGGGTGTACGTGGATGGGA
CTGATGTGGCCGTCCAGGGATTCCCTTTCCCAGTCAACTTGCAAGTCGACTTTACGTTGAACTCTTCGATACCTGCATTAGCTGGGTACTCCTTCTACACCGGCACCGCCGATTCGGCGG
GTGTACAGTTGAGCATGGATGTTCATGCCGTTACCTCGTCGCAAACGTATACCCAGACCTTCCAGCAGACCCTCCTGCTTGATAATACGCCATATGTGAAACCTGGAACTACGACCACCA
CTGCCTCCAAAAGTGCTGCAGGTCGGATGGCTGTGCCGTTGATGGGAATCGACTTATGGAACACACTGCTCGTCCTTCCGGGGGTGTTCTTCTACCTAAACGGGAACTTGCTGGATCTTG
TTCTG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGGGCTTCCTTTAGTCTTCTCTCTCTATCTTTTATCTCTCGTTACCCCCTTTTCTTCTGCCTACACATGGCCTTCGCCACAATATGATACTCTTGAAGCCCTTTTGTATGAAGGT
CGCCGCTCCGATGGCTCCAGCCTCTCTTCTCTCGTCCATCCATGTCGGAAACGAACGGGAACTCTCGCCTCAGTTCCTGCTGAATGGCTTCGTTTT
GCTTTTCACGACATGGCAACCCAT
AACGTTGACAATGGCATGGGTGGATTGGATGGTTCAATTGCGTACGAACTTGACCGTGCGGAG
AACTTTGGTCTCGGCTTCAACCAGACCTTAAGTGACTTCGAGGCCTATCCTAATAAA
CTAGTCTCCA
GAGCCGATATCTTTGCCATAGGCGCCATCATGGCTGTAAACACGTGCGGCGGGCCCATTCTTCCATTTCGTGGCGGCCGTATCGATGCTTGGTCGGCTGGTGGTACCGGC
ACGCCTGAGCCCCAGCAAGACCTTCCGACTCTTACAGAGAGCTTCAGAAAGCAGGGGTACAGTCAAAGCGAGATGATCAAACTCGTTGCCTGCGGCCATACTATGGGTGGTGTCAGGAGC
GCCGACTTTCCCCAGCTCGTTGCGCCTGACCCCAACTCTATTTATCCAGTTATCAAGAACTTTGACACCACTACCGAAAAATTTGATAATGCTGT
TGTCACAGAATATCTCAATGGATCT
ACGCAAAATCTCCTCGTTGTTAGCGCGAACCAAACCATGGACTCTGATCTCCGCGTATTTCAGAGTGATAATAACAGCACGATTCGGAG
TATGGCAGATAACACAGTCTTTCAGTCAGAG
TGTCAGAGTATTCTGACACGTATGATTGACACTGTACCGGCATCTGTAACCCTGACGGACGAAATTACTCTTCTGCCTGCCAAAGTCACTTACGCACAACTCACATTTGAGAAAAATCAG
TTTATCTTCAAGACAAATTTCCGC
TTGACGCAAGCTATCAATGCCACAGCAAACGCTAATCGCAATGTCACCTTGTTCTGGTGTGACAGATATGGCGATAACCAAAACTGTGCTCACAAG
ACCAGCACTGCGTTGCCCGTCAACAAGGTTGCAGATGACCCAGGCGTGTCGCCAGTTACCCAAACTCTCGGGTACTACTTCTTGAACTACAATTTTGTCATTCCTATCAACACCAATACC
TCAATTGCTAAATTTTGGTTTGAGGTGGACGAACATGATGGAAGCAAGGTGACAACCTACAATAACGGTGGCAGCAACTACGTTATCGATCAGGATCAGGTCCTCTTCGTCCCTATGTCT
AGTCACATGTCTATTGTCCCCAACACTACTGCTACCCAAACCTACACGAACAGAGTTGGTGACGGCAACACTCGTCATTATTCTCTCGTCATCGCCGTGCGGGATGGCACGAACCCCTCA
CGGGTGTACGTGGATGGGACTGATGTGGCCGTCCAGGGATTCCCTTTCCCAGTCAACTTGCAAGTCGACTTTACGTTGAACTCTTCGATACCTGCATTAGCTGGGTACTCCTTCTACACC
GGCACCGCCGATTCGGCGGGTGTACAGTTGAGCATGGATGTTCATGCCGTTACCTCGTCGCAAACGTATACCCAGACCTTCCAGCAGACCCTCCTGCTTGATAATACGCCATATGTGAAA
CCTGGAACTACGACCACCACTGCCTCCAAAAGTGCTGCAGGTCGGATGGCTGTGCCGTTGATGGGAATCGACTTATGGAACACACTGCTCGTCCTTCCGGGGGTGTTCTTCTACCTAAAC
GGGAACTTGCTGGATCTTGTTCTG

Retrieve as FASTA