Entry information : HEC38CcP01
Entry ID 11929
Creation 2013-05-28 (Nizar Fawal)
Last sequence changes 2013-05-28 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-25 (Catherine Mathe (Scipio))
Peroxidase information: HEC38CcP01
Name HEC38CcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. EC38    [TaxId: 1001937 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HEC38CcP01
start..stop
S start..stop
HCO27CcP01 738 0 1..359 1..359
DescCcP01 630 0 10..359 1..357
HC14CcP01 627 0 1..359 1..358
AmonCcP01 571 0 1..359 1..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17690..18182 493 N° 2 18253..18839 587  
join(17690..18182,18253..18839)


exon

Literature and cross-references HEC38CcP01
DNA ref. JGI genome:   scaffold_225 (17690..18839)
Cluster/Prediction ref. JGI gene:   395149
Protein sequence: HEC38CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360
PWM (Da):   %s   39949  
PI (pH):   %s   8.81
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSAPIVSRQLARATLRTTARNTFATSARQTFRQHSGRRFYSSESTKASSSSSLVYLAGAAVAGAAGYYFYTQGSSAGVKVINPTKEDYQKVYDEIAKLLEENDDYDDGSYGPVLLRLAWHASGTYDKETGTGGSNGATMRFSPEGDHGANAGLKIARDFLEPVKAKFPWISYSDLWIIGGIAAIQEMQGPTIPFRPGRQDRDAAACTPDGRLPDGAKGSDHLRNIFYRMGFNDQEIVALAGAHALGRCHPDRSGFDGPWTFSPTVLTNDYYRLLLEEKWQFKKWDGPKQYEDAKTKSLMMLPADYALIQDKGFRPWVEKYAKDNDLFFKDFAAAVTKLFELGVPFKQDTERIIFKPRNA

Retrieve as FASTA  
Remarks complete sequence from genomics (2 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTCCGATCGTATCTCGTCAGCTCGCTCGTGCGACTCTACGCACCACCGCTAGAAACACATTTGCAACCTCTGCAAGACAGACGTTCCGACAACATAGCGGCCGTCGCTTCTAC
TCATCCGAATCCACCAAAGCCTCGAGCTCGTCCTCTCTGGTCTACTTAGCGGGTGCCGCCGTTGCTGGTGCTGCTGGTTACTATTTCTACACACAAGGCTCTTCGGCCGGCGTTAAGGTC
ATTAACCCCACTAAGGAGGACTACCAGAAAGTGTACGACGAGATTGCCAAGCTCCTGGAGGAGAACGACGACTATGATGATGGTAGCTACGGCCCGGTCCTCCTGCGTCTGGCATGGCAC
GCTAGCGGTACCTATGATAAGGAGACCGGTACCGGTGGCAGCAATGGTGCTACTATGCGATTCTCTCCCGAGGGTGACCACGGTGCGAACGCTGGCTTGAAGATTGCTCGGGACTTTCTT
GAGCCTGTGAAAG
GTGAGTCATGTGGCAATGTCTCGCCCTTGCATGGTTAAGACAAGCTTGGCTGACGCACATATTTTTTTAGCCAAGTTCCCGTGGATCAGCTACTCCGATCTTTGGAT
CATTGGCGGTATTGCTGCCATTCAGGAGATGCAGGGCCCCACTATCCCGTTCCGACCTGGTCGTCAGGACCGAGATGCTGCGGCTTGCACCCCTGACGGACGTCTCCCCGACGGGGCCAA
GGGTTCTGACCACCTCCGTAACATCTTCTACCGCATGGGCTTCAATGACCAAGAAATTGTTGCCCTTGCTGGTGCTCACGCCCTTGGACGATGCCACCCCGACCGAAGCGGCTTCGACGG
ACCGTGGACATTCTCACCCACTGTTCTGACCAACGACTACTACCGCCTCCTCCTCGAGGAGAAGTGGCAGTTCAAGAAGTGGGACGGACCCAAGCAGTACGAGGACGCCAAGACCAAGTC
TCTTATGATGCTGCCGGCAGACTACGCCCTCATCCAAGACAAGGGTTTCAGGCCCTGGGTGGAGAAGTACGCCAAGGACAACGATCTTTTCTTCAAGGACTTTGCCGCGGCGGTTACCAA
GCTGTTCGAGCTCGGCGTTCCCTTCAAGCAGGACACCGAGAGGATCATCTTCAAGCCCCGCAACGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTCCGATCGTATCTCGTCAGCTCGCTCGTGCGACTCTACGCACCACCGCTAGAAACACATTTGCAACCTCTGCAAGACAGACGTTCCGACAACATAGCGGCCGTCGCTTCTAC
TCATCCGAATCCACCAAAGCCTCGAGCTCGTCCTCTCTGGTCTACTTAGCGGGTGCCGCCGTTGCTGGTGCTGCTGGTTACTATTTCTACACACAAGGCTCTTCGGCCGGCGTTAAGGTC
ATTAACCCCACTAAGGAGGACTACCAGAAAGTGTACGACGAGATTGCCAAGCTCCTGGAGGAGAACGACGACTATGATGATGGTAGCTACGGCCCGGTCCTCCTGCGTCTGGCATGGCAC
GCTAGCGGTACCTATGATAAGGAGACCGGTACCGGTGGCAGCAATGGTGCTACTATGCGATTCTCTCCCGAGGGTGACCACGGTGCGAACGCTGGCTTGAAGATTGCTCGGGACTTTCTT
GAGCCTGTGAAAG
CCAAGTTCCCGTGGATCAGCTACTCCGATCTTTGGATCATTGGCGGTATTGCTGCCATTCAGGAGATGCAGGGCCCCACTATCCCGTTCCGACCTGGTCGTCAGGAC
CGAGATGCTGCGGCTTGCACCCCTGACGGACGTCTCCCCGACGGGGCCAAGGGTTCTGACCACCTCCGTAACATCTTCTACCGCATGGGCTTCAATGACCAAGAAATTGTTGCCCTTGCT
GGTGCTCACGCCCTTGGACGATGCCACCCCGACCGAAGCGGCTTCGACGGACCGTGGACATTCTCACCCACTGTTCTGACCAACGACTACTACCGCCTCCTCCTCGAGGAGAAGTGGCAG
TTCAAGAAGTGGGACGGACCCAAGCAGTACGAGGACGCCAAGACCAAGTCTCTTATGATGCTGCCGGCAGACTACGCCCTCATCCAAGACAAGGGTTTCAGGCCCTGGGTGGAGAAGTAC
GCCAAGGACAACGATCTTTTCTTCAAGGACTTTGCCGCGGCGGTTACCAAGCTGTTCGAGCTCGGCGTTCCCTTCAAGCAGGACACCGAGAGGATCATCTTCAAGCCCCGCAACGCTTAA

Retrieve as FASTA