Entry information : HEC38APx-CcP01
Entry ID 11931
Creation 2013-05-28 (Nizar Fawal)
Last sequence changes 2013-05-28 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-25 (Catherine Mathe (Scipio))
Peroxidase information: HEC38APx-CcP01
Name HEC38APx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. EC38    [TaxId: 1001937 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HEC38APx-CcP01
start..stop
S start..stop
HCO27APx-CcP01 919 0 1..510 1..482
HC14APx-CcP01 852 0 1..510 22..542
DescAPx-CcP01 833 0 1..510 21..530
AmonAPx-CcP03 570 0 1..510 27..542
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 329550..329880 331 N° 2 329251..329474 224 N° 3 328715..329125 411 N° 4 328085..328651 567
complement(join(328085..328651,328715..329125,329251..329474,329550..329880))


exon

Literature and cross-references HEC38APx-CcP01
DNA ref. JGI genome:   scaffold_1 (329880..328085)
Cluster/Prediction ref. JGI gene:   30961
Protein sequence: HEC38APx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   511
PWM (Da):   %s   54040.88  
PI (pH):   %s   4.24
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFYYPSPAAWALEHILVDNWGAYASNFSSAITPCENYVTEVGLPAIKSRRTTAAQWLRVAFHDFATADVATGTGGVDASIGFETEREENSGTAFNDSFTFWQPFVNEFVPMADLLAVGTVMSVHLCGGKYIPYQYGRVDATAADPKTGVPEPSTSVEETLAQFEQAGFNQSDAIALTACGHTMGVHAGGFPQVVEQYHITPNNTNGAVDLDSTRAVFDSAVVHEYIDSTGARGGPLVTSFNESSRSDLRLYESDSNKTMLELYAQGDGFQDTCVNLLSRMLNTVPSNVQLQPAIAPALLKPINVTWDVSSDNQIVLSGKIRVLYAGEVLADPVSITFSNGHTETLVPEEGLGISAFKLAGSQTNATAKYSPFSILSISLLGASSFTVAATGFEAQTFQIQDKAFIVPSLTSVADGKVSVTVAARTNQSDFDTSQVSVKVATPIAQPLTLAPKIVRTGVQLEEGQSPLTNIGYWTGSTAIDNPTGAVSVTLLSGEDVIDTLLLGAGVAGW*

Retrieve as FASTA  
Remarks complete sequence from genomics (3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTACTATCCGAGCCCCGCAGCGTGGGCCCTAGAGCACATTTTAGTGGACAATTGGGGTGCATATGCCTCTAATTTCTCATCCGCTATAACGCCCTGCGAAAACTACGTTACCGAG
GTGGGCTTGCCAGCCATCAAATCACGCAGGACGACGGCTGCACAATGGCTACGGGTTGCTTTCCACGACTTCGCTACCGCCGACGTCGCTACTGGAACGGGCGGTGTGGATGCCAGTATC
GGGTTCGAGACCGAGCGCGAGGAAAACTCCGGCACCGCATTCAATGACAGCTTCACGTTTTGGCAGCCTTTCGTCAATGAGTTCGTTCCTA
GTAAGCTAGCTATACTATCCCGGTGCGGT
ACCTCTACTTGATTTTGAGCATGTCATGCTGAGTGGGGGTCTTAAGTGGCGGATCTGCTTGCCGTCGGGACGGTGATGTCTGTACATCTATGTGGGGGCAAATACATTCCGTACCAATAT
GGCAGGGTAGACGCAACGGCGGCCGATCCGAAGACAGGAGTGCCGGAGCCGAGCACGAGCGTGGAGGAGACTCTCGCCCAGTTTGAGCAAGCCGGCTTCAATCAATCGGATGCCATTGCC
TTGACTGCCTGTGGTCACACCATGGGATCC
GTAAGTCAGCGTGCGCTTCCTTATTCCAATGCCATAGTTCGCATATTGGATTGTCTCTATCGGGACCTAGCGTCCTGGATGAGGTATTGC
AATACTATAGCTGGATATTAACCAGGACTGCGTAGGTACACGCCGGTGGCTTTCCACAAGTAGTCGAACAGTACCACATTACCCCGAACAACACCAACGGCGCAGTCGACCTGGACAGCA
CCCGGGCAGTGTTTGATTCGGCGGTAGTGCATGAGTACATCGATAGCACAGGGGCTAGAGGTGGTCCGCTCGTAACTAGCTTCAATGAGAGTAGTAGGTCGGATCTGCGACTGTATGAGA
GCGACAGCAACAAGACTATGCTTGAGCTATACGCGCAGGGAGACGGGTTCCAGGACACTTGCGTTAACTTGTTGAGTCGCATGCTCAACACCGTTCCCTCCAATGTACAACTTCAGCCTG
CAATTGCGCCAGCGCTCCTCAAGCCGATTAACGTGACTTGGGATGTCAGCAGCGACAACCAGATAGTCCTGTCTGGAAAGATAAGG
GTATGTGATAGAATATCCATTAACATGTGGAATC
CATGACCACCATAACTAAAACTTAATCAGGTGCTATACGCTGGGGAAGTATTGGCCGACCCAGTCTCAATCACCTTCTCGAATGGTCATACGGAGACCCTGGTTCCTGAGGAGGGCTTGG
GTATCTCTGCGTTTAAACTGGCCGGTAGCCAAACCAACGCTACCGCAAAATATTCGCCTTTCTCAATCCTTAGCATTAGCTTATTAGGAGCGTCATCCTTCACTGTCGCGGCAACGGGAT
TCGAAGCCCAAACCTTCCAGATTCAAGATAAAGCTTTCATTGTCCCAAGCCTGACTAGTGTCGCGGACGGCAAAGTGTCCGTCACGGTCGCGGCGAGGACTAATCAATCCGACTTTGATA
CATCCCAAGTATCTGTGAAGGTTGCAACTCCAATTGCGCAGCCGCTTACTCTTGCGCCTAAGATCGTCCGGACCGGCGTGCAACTCGAGGAAGGCCAGAGTCCATTAACGAATATTGGTT
ACTGGACTGGATCTACTGCAATTGACAATCCTACTGGCGCCGTCAGTGTGACCTTGCTCTCTGGTGAGGATGTCATCGACACCCTATTGCTTGGTGCTGGTGTTGCAGGTTGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTACTATCCGAGCCCCGCAGCGTGGGCCCTAGAGCACATTTTAGTGGACAATTGGGGTGCATATGCCTCTAATTTCTCATCCGCTATAACGCCCTGCGAAAACTACGTTACCGAG
GTGGGCTTGCCAGCCATCAAATCACGCAGGACGACGGCTGCACAATGGCTACGGGTTGCTTTCCACGACTTCGCTACCGCCGACGTCGCTACTGGAACGGGCGGTGTGGATGCCAGTATC
GGGTTCGAGACCGAGCGCGAGGAAAACTCCGGCACCGCATTCAATGACAGCTTCACGTTTTGGCAGCCTTTCGTCAATGAGTTCGTTCCTA
TGGCGGATCTGCTTGCCGTCGGGACGGTG
ATGTCTGTACATCTATGTGGGGGCAAATACATTCCGTACCAATATGGCAGGGTAGACGCAACGGCGGCCGATCCGAAGACAGGAGTGCCGGAGCCGAGCACGAGCGTGGAGGAGACTCTC
GCCCAGTTTGAGCAAGCCGGCTTCAATCAATCGGATGCCATTGCCTTGACTGCCTGTGGTCACACCATGGGATCC
GTACACGCCGGTGGCTTTCCACAAGTAGTCGAACAGTACCACATT
ACCCCGAACAACACCAACGGCGCAGTCGACCTGGACAGCACCCGGGCAGTGTTTGATTCGGCGGTAGTGCATGAGTACATCGATAGCACAGGGGCTAGAGGTGGTCCGCTCGTAACTAGC
TTCAATGAGAGTAGTAGGTCGGATCTGCGACTGTATGAGAGCGACAGCAACAAGACTATGCTTGAGCTATACGCGCAGGGAGACGGGTTCCAGGACACTTGCGTTAACTTGTTGAGTCGC
ATGCTCAACACCGTTCCCTCCAATGTACAACTTCAGCCTGCAATTGCGCCAGCGCTCCTCAAGCCGATTAACGTGACTTGGGATGTCAGCAGCGACAACCAGATAGTCCTGTCTGGAAAG
ATAAGG
GTGCTATACGCTGGGGAAGTATTGGCCGACCCAGTCTCAATCACCTTCTCGAATGGTCATACGGAGACCCTGGTTCCTGAGGAGGGCTTGGGTATCTCTGCGTTTAAACTGGCC
GGTAGCCAAACCAACGCTACCGCAAAATATTCGCCTTTCTCAATCCTTAGCATTAGCTTATTAGGAGCGTCATCCTTCACTGTCGCGGCAACGGGATTCGAAGCCCAAACCTTCCAGATT
CAAGATAAAGCTTTCATTGTCCCAAGCCTGACTAGTGTCGCGGACGGCAAAGTGTCCGTCACGGTCGCGGCGAGGACTAATCAATCCGACTTTGATACATCCCAAGTATCTGTGAAGGTT
GCAACTCCAATTGCGCAGCCGCTTACTCTTGCGCCTAAGATCGTCCGGACCGGCGTGCAACTCGAGGAAGGCCAGAGTCCATTAACGAATATTGGTTACTGGACTGGATCTACTGCAATT
GACAATCCTACTGGCGCCGTCAGTGTGACCTTGCTCTCTGGTGAGGATGTCATCGACACCCTATTGCTTGGTGCTGGTGTTGCAGGTTGGTGA

Retrieve as FASTA