Entry information : HEC38APx-CcP02
Entry ID 11934
Creation 2013-05-28 (Nizar Fawal)
Last sequence changes 2013-05-28 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-25 (Catherine Mathe (Scipio))
Peroxidase information: HEC38APx-CcP02
Name HEC38APx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. EC38    [TaxId: 1001937 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HEC38APx-CcP02
start..stop
S start..stop
HCO27APx-CcP02 1056 0 1..551 1..550
HC14APx-CcP03 869 0 1..551 1..550
TatAPx-CcP02 469 2e-161 29..550 26..548
ElaAPx-CcP1 463 5e-159 28..549 22..536
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 361578..362243 666 N° 2 362297..362355 59 N° 3 362416..362710 295 N° 4 362770..363132 363
N° 5 363187..363462 276  
join(361578..362243,362297..362355,362416..362710,362770..363132,363187..363462)


exon

Literature and cross-references HEC38APx-CcP02
DNA ref. JGI genome:   scaffold_4 (361578..363462)
Cluster/Prediction ref. JGI gene:   798
Protein sequence: HEC38APx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   553 (526)
PWM (Da):   %s   60052.14 (57367.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.35 (4.35) Peptide Signal:   %s   cut: 27 range:27-552
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSISSSWATLILAALAIIANGVVTACTWPDAQIDQLESILYQHNGYRQYGLAFGVSPCNNMANTLETGRDDSAEWFRTAYHDMATANMQAGIGGIDASIGFETDRPENKGKAFNESVSFFTAFQSARSAMADVIALGALFSVGSCSNGEVIIPFRGGRRDALGPGPTGVPQPEEDLDTHMAAFARQGFNVTEMIGLVACGHTIGGVHGENFPEIVPVVNDMNNQASRQDFDESFDNFDNSVAKQFVANTTQNPLAFGHNETTRSDFRIFNADGGNLIRRMAESQQFFWDMCTTLLERMLNTVPRDVQLTDVIQPIQIKPNNLFITVNSNGTETVSGEVIIEDGTTSSNREVFIHLKSRTGEAVPSSPILARTQDGMQVYAFYNNMPNFTFYSFTTTVPTGVGVSSFDVQIKDGDTDTTSTNGGQGFPMQDVLIVQQASTCTRLEFPSMKSNNTLEITVAVRDDMEFDSVQLVVPKPVNMIGTLSLRFEPTAVDIGKVQTLDGTGYSLYKGSFSFLVDGVGPMKTFDLVASGSKGVVQSNLTRWAEFDFCE*

Retrieve as FASTA  
Remarks complete sequence from genomics (4 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACATCCATATCTAGTTCCTGGGCGACGCTTATTTTAGCTGCACTCGCCATAATTGCGAATGGTGTGGTCACCGCATGCACATGGCCAGACGCTCAGATAGACCAGCTCGAAAGTATC
CTCTACCAGCACAATGGCTATCGCCAGTATGGATTAGCCTTCGGCGTCTCGCCCTGCAATAACATGGCAAACACGCTGGAAACGGGTCGTGACGACTCAGCAGAATGGTTCCGCACGGCA
TATCACGACATGGCGACTGCAAATATGCAAGCCGGAATTGGTGGGATAGATGCATCGATCGGGTTTGAGACGGACCGGCCGGAGAATAAGGGCAAAGCATTTAACGAATCAGTTAGTTTC
TTCACCGCCTTCCAGAGCGCTCGGTCCGCCATGGCAGACGTGATAGCTCTCGGGGCCCTGTTTTCGGTTGGGTCGTGCTCGAATGGAGAAGTAATCATCCCCTTTCGTGGCGGGAGGCGG
GATGCCCTCGGTCCGGGTCCAACAGGGGTGCCACAGCCAGAAGAAGACTTAGACACCCATATGGCTGCGTTCGCCAGACAAGGTTTCAATGTCACGGAGATGATCGGACTGGTGGCTTGT
GGTCATACGATTGGCGGCGTCCATGGAGAGAACTTCCCAGAAATCGTTCCTGTGGTGAACGATATG
GTGAGCCGATGAATAGGGGTATAAAAAGGGGCTGTGCTAACATAGCGATGCAGA
ACAATCAAGCGAGCCGTCAAGACTTTGATGAATCGTTCGATAACTTTGATAATAGCGT
GTAAGTTATGGTGACCGACTAGAAAAATGTTCCATAAAGCTCCGAGCTAACTGTGAGCAGTG
CCAAGCAATTCGTGGCTAATACCACGCAGAATCCTTTGGCGTTTGGGCATAACGAAACGACTAGGTCTGACTTCCGCATCTTCAACGCAGATGGCGGTAACTTGATTAGGCGCATGGCGG
AATCGCAACAGTTCTTCTGGGACATGTGTACCACGCTACTAGAGCGGATGCTCAACACTGTCCCGAGAGATGTCCAGTTAACGGATGTCATCCAACCGATTCAAATTAAGCCCAATAATC
TGTTCATCACGGTTAACTCCAATGGGACCGAGACGGTTTCAGGAGAGGTTCGG
GTAAGGAGTTTGCGACTAGCATCCTTCGTGGTGAATTGAAATGACTTACAGGAGAACAGATAATAGA
AGACGGCACAACATCTAGCAACCGTGAGGTTTTTATTCATTTGAAATCTAGAACTGGTGAAGCGGTCCCTTCCAGCCCAATTTTAGCGCGAACACAAGACGGCATGCAGGTGTACGCCTT
CTATAATAACATGCCAAACTTCACATTCTATTCTTTTACGACGACCGTGCCTACTGGAGTTGGAGTGTCCTCCTTCGATGTGCAGATCAAGGATGGTGACACAGATACAACCAGTACGAA
CGGTGGCCAGGGCTTCCCTATGCAGGACGTTCTTATCGTACAACAAGCAAGTACATGTACCAGACTTGAGTTTCCCAGCATGAAGTCCAACAACACGTTAGAAATAACCGTAGCT
GTCAG
CCTCATCCCGTATCTGTTCTTTGTTATACTACTCTAACCCTCATTGAAGGTCCGCGACGACATGGAATTCGACTCAGTACAATTAGTGGTGCCGAAGCCGGTCAACATGATCGGTACGTT
ATCATTGCGCTTCGAGCCGACGGCGGTTGATATAGGAAAGGTTCAGACGTTGGACGGAACCGGATACTCGCTGTACAAGGGTTCGTTCTCGTTTTTAGTAGATGGAGTCGGCCCGATGAA
GACGTTCGACCTGGTTGCTTCGGGGTCGAAGGGTGTTGTGCAGAGTAATTTAACAAGATGGGCCGAGTTCGACTTTTGCGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACATCCATATCTAGTTCCTGGGCGACGCTTATTTTAGCTGCACTCGCCATAATTGCGAATGGTGTGGTCACCGCATGCACATGGCCAGACGCTCAGATAGACCAGCTCGAAAGTATC
CTCTACCAGCACAATGGCTATCGCCAGTATGGATTAGCCTTCGGCGTCTCGCCCTGCAATAACATGGCAAACACGCTGGAAACGGGTCGTGACGACTCAGCAGAATGGTTCCGCACGGCA
TATCACGACATGGCGACTGCAAATATGCAAGCCGGAATTGGTGGGATAGATGCATCGATCGGGTTTGAGACGGACCGGCCGGAGAATAAGGGCAAAGCATTTAACGAATCAGTTAGTTTC
TTCACCGCCTTCCAGAGCGCTCGGTCCGCCATGGCAGACGTGATAGCTCTCGGGGCCCTGTTTTCGGTTGGGTCGTGCTCGAATGGAGAAGTAATCATCCCCTTTCGTGGCGGGAGGCGG
GATGCCCTCGGTCCGGGTCCAACAGGGGTGCCACAGCCAGAAGAAGACTTAGACACCCATATGGCTGCGTTCGCCAGACAAGGTTTCAATGTCACGGAGATGATCGGACTGGTGGCTTGT
GGTCATACGATTGGCGGCGTCCATGGAGAGAACTTCCCAGAAATCGTTCCTGTGGTGAACGATATG
AACAATCAAGCGAGCCGTCAAGACTTTGATGAATCGTTCGATAACTTTGATAAT
AGCGT
TGCCAAGCAATTCGTGGCTAATACCACGCAGAATCCTTTGGCGTTTGGGCATAACGAAACGACTAGGTCTGACTTCCGCATCTTCAACGCAGATGGCGGTAACTTGATTAGGCGC
ATGGCGGAATCGCAACAGTTCTTCTGGGACATGTGTACCACGCTACTAGAGCGGATGCTCAACACTGTCCCGAGAGATGTCCAGTTAACGGATGTCATCCAACCGATTCAAATTAAGCCC
AATAATCTGTTCATCACGGTTAACTCCAATGGGACCGAGACGGTTTCAGGAGAGGTTCGG
ATAATAGAAGACGGCACAACATCTAGCAACCGTGAGGTTTTTATTCATTTGAAATCTAGA
ACTGGTGAAGCGGTCCCTTCCAGCCCAATTTTAGCGCGAACACAAGACGGCATGCAGGTGTACGCCTTCTATAATAACATGCCAAACTTCACATTCTATTCTTTTACGACGACCGTGCCT
ACTGGAGTTGGAGTGTCCTCCTTCGATGTGCAGATCAAGGATGGTGACACAGATACAACCAGTACGAACGGTGGCCAGGGCTTCCCTATGCAGGACGTTCTTATCGTACAACAAGCAAGT
ACATGTACCAGACTTGAGTTTCCCAGCATGAAGTCCAACAACACGTTAGAAATAACCGTAGCT
GTCCGCGACGACATGGAATTCGACTCAGTACAATTAGTGGTGCCGAAGCCGGTCAAC
ATGATCGGTACGTTATCATTGCGCTTCGAGCCGACGGCGGTTGATATAGGAAAGGTTCAGACGTTGGACGGAACCGGATACTCGCTGTACAAGGGTTCGTTCTCGTTTTTAGTAGATGGA
GTCGGCCCGATGAAGACGTTCGACCTGGTTGCTTCGGGGTCGAAGGGTGTTGTGCAGAGTAATTTAACAAGATGGGCCGAGTTCGACTTTTGCGAGTAG

Retrieve as FASTA