Entry information : HCO27GPx01
Entry ID 11937
Creation 2013-05-28 (Nizar Fawal)
Last sequence changes 2016-03-08 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-03-08 (Achraf Jemmat)
Peroxidase information: HCO27GPx01
Name HCO27GPx01
Class Fungi-Bacteria glutathione peroxidase    [Orthogroup: Gpx3001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. CO27-5    [TaxId: 1001938 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HCO27GPx01
start..stop
S start..stop
HEC38GPx01 513 0 1..248 1..248
DescGPx01 393 2e-140 1..248 1..257
HC14GPx 380 2e-135 1..244 1..251
HC14GPx01 315 3e-111 80..244 1..165
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20352..20631 280 N° 2 19815..20281 467  
complement(join(19815..20281,20352..20631))


exon

Literature and cross-references HCO27GPx01
DNA ref. JGI genome:   scaffold_65 (20631..19815)
Cluster/Prediction ref. JGI gene:   396503
Protein sequence: HCO27GPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   249
PWM (Da):   %s   27952.2  
PI (pH):   %s   9.73
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTQVVIRSWHPTHSIFNRFCRVTSSNLCSTALSSKRRLASFRYPADESTIATFTSLTSATSTPRHPRHYISTITNTTRTMASATTFYDFKVKDKKGNEKSLADYKGKVVLVVNTASKCGFTPQYAGLEKLYKDITAKYPDDFVILGFPCNQFGGQEPGTDDDIQSFCQVNYGVTFPIMGKTDVNGDKAEPVFEWMKAEKPGLLGMKRVKWNFEKFLIGRDGKVKERWASTTKPESLEKPILEELEKKA

Retrieve as FASTA  
Remarks complete sequence from genomics (1 intron). Incorrect prediction from JGI (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACAAGTCGTTATAAGGAGCTGGCATCCCACGCATTCAATCTTCAACCGTTTCTGCAGAGTGACTTCATCAAATCTGTGTAGTACAGCCTTATCATCTAAACGTCGATTAGCGAGT
TTCAGATACCCCGCTGACGAGAGCACTATCGCGACTTTTACAAGCTTAACCTCAGCTACAAGTACCCCGCGACATCCGAGACATTATATCTCTACCATCACCAACACAACCCGCACAATG
GCTTCAGCTACGACATTCTACGACTTCAAGGTCAAGGACA
GTACGTAGTGCGGAACCAATGCTTAGACACCATATGGACATATGCTAACGGCTACTACCCTTGCCAACAGAGAAGGGTAA
CGAGAAGTCCTTAGCCGACTACAAGGGCAAGGTAGTACTAGTCGTCAACACAGCGTCCAAGTGCGGCTTCACACCGCAATACGCCGGACTCGAAAAGCTATACAAAGATATCACGGCGAA
GTACCCCGATGATTTCGTTATCCTAGGCTTCCCTTGCAACCAATTCGGCGGCCAGGAACCCGGCACCGACGATGACATCCAGAGCTTCTGCCAAGTCAACTACGGCGTGACCTTCCCCAT
CATGGGCAAGACGGACGTGAACGGCGACAAGGCCGAGCCGGTGTTCGAGTGGATGAAGGCCGAGAAGCCTGGGCTCCTGGGCATGAAGCGCGTGAAGTGGAACTTTGAGAAGTTCCTGAT
CGGAAGGGACGGCAAGGTCAAGGAGCGGTGGGCCAGTACCACCAAGCCGGAGAGTTTGGAGAAGCCTATCTTGGAGGAGCTGGAGAAGAAGGCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACAAGTCGTTATAAGGAGCTGGCATCCCACGCATTCAATCTTCAACCGTTTCTGCAGAGTGACTTCATCAAATCTGTGTAGTACAGCCTTATCATCTAAACGTCGATTAGCGAGT
TTCAGATACCCCGCTGACGAGAGCACTATCGCGACTTTTACAAGCTTAACCTCAGCTACAAGTACCCCGCGACATCCGAGACATTATATCTCTACCATCACCAACACAACCCGCACAATG
GCTTCAGCTACGACATTCTACGACTTCAAGGTCAAGGACA
AGAAGGGTAACGAGAAGTCCTTAGCCGACTACAAGGGCAAGGTAGTACTAGTCGTCAACACAGCGTCCAAGTGCGGCTTC
ACACCGCAATACGCCGGACTCGAAAAGCTATACAAAGATATCACGGCGAAGTACCCCGATGATTTCGTTATCCTAGGCTTCCCTTGCAACCAATTCGGCGGCCAGGAACCCGGCACCGAC
GATGACATCCAGAGCTTCTGCCAAGTCAACTACGGCGTGACCTTCCCCATCATGGGCAAGACGGACGTGAACGGCGACAAGGCCGAGCCGGTGTTCGAGTGGATGAAGGCCGAGAAGCCT
GGGCTCCTGGGCATGAAGCGCGTGAAGTGGAACTTTGAGAAGTTCCTGATCGGAAGGGACGGCAAGGTCAAGGAGCGGTGGGCCAGTACCACCAAGCCGGAGAGTTTGGAGAAGCCTATC
TTGGAGGAGCTGGAGAAGAAGGCGTAA

Retrieve as FASTA