Entry information : HCO27APx-CcP01
Entry ID 11941
Creation 2013-05-28 (Nizar Fawal)
Last sequence changes 2013-05-28 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-25 (Catherine Mathe (Scipio))
Peroxidase information: HCO27APx-CcP01
Name HCO27APx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. CO27-5    [TaxId: 1001938 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HCO27APx-CcP01
start..stop
S start..stop
HEC38APx-CcP01 919 0 1..482 1..510
HC14APx-CcP01 820 0 1..482 22..542
DescAPx-CcP01 786 0 1..482 21..530
AmonAPx-CcP03 563 0 1..482 27..542
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 166890..167220 331 N° 2 166591..166814 224 N° 3 166047..166457 411 N° 4 165417..165899 483
complement(join(165417..165899,166047..166457,166591..166814,166890..167220))


exon

Literature and cross-references HCO27APx-CcP01
DNA ref. JGI genome:   scaffold_11 (167220..165417)
Cluster/Prediction ref. JGI gene:   373620
Protein sequence: HCO27APx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   483
PWM (Da):   %s   51245.38  
PI (pH):   %s   4.21
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFYYPSPAASALEHILVDNWGAYASNFSSAITPCENYVTEVGLPAINSRRTTAAQWLRVAFHDFATADVAAGTGGVDASIGFETEREENSGTAFNDSFTFWQPFVNEFVPMADLLAVGTVMSVHLCGGKYIPYQYGRVDATEADPKTGVPEPSTSVEETLAQFEQAGFNQSDAIALTACGHTMGVHAGGFPEVVEQYHITPNNTNGAVDLDSTRAVFDSAVVHEYIDNTGARGGPLVTSFNETSRSDLRLYESDSNKTMLELYAQGDEFQDTCVNLLSRMLNTVPSSVQLQPAITPALLKPINVTWDVTSDNQLVLSGKIRSLGISAFKLAGSQTNATAQYSPFSIPSTSLSGTSSFTVAATGFEAQTFQIQDKAFIVPSLTSVADGKVSVTVAVRTNQPDFDTSQVSVKVATPIAQPLTLAPKIVRANVQLEEGQSPLTNISYWTGSTIIVNPTGAVSVTLLSGEDVIDTLLLGAGVAGW*

Retrieve as FASTA  
Remarks complete sequence from genomics (3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTACTATCCGAGCCCCGCAGCATCGGCCCTAGAGCACATTCTAGTGGACAATTGGGGCGCATACGCCTCTAATTTCTCATCCGCTATAACGCCCTGCGAAAACTACGTTACCGAA
GTAGGCTTGCCGGCCATCAACTCCCGCAGGACGACGGCTGCACAATGGCTACGGGTTGCTTTCCACGACTTCGCTACCGCCGACGTCGCAGCTGGCACCGGCGGTGTGGATGCCAGTATC
GGGTTTGAGACTGAGCGCGAGGAAAACTCCGGCACCGCATTCAATGACAGCTTCACATTCTGGCAGCCCTTCGTTAATGAGTTCGTTCCTA
GTAAGCTAACTATACTATCCCGGTGCGGT
ACCTCTACTTGATTTTGAGCATGTCATGCTGAGTGGGGGTCTTAAGTGGCGGATCTGCTTGCCGTCGGAACGGTGATGTCTGTTCATCTATGTGGGGGCAAGTACATACCGTACCAGTAT
GGCAGGGTAGACGCGACGGAAGCCGATCCGAAGACTGGTGTGCCGGAGCCGAGCACGAGCGTGGAGGAGACGCTCGCCCAGTTTGAGCAAGCCGGCTTCAATCAATCGGATGCCATTGCC
TTGACTGCATGTGGTCACACCATGGGATCC
GTAAGTCAACTCCCTAAGTGTGCGCTTCCTTAATCCAATGTCATGGTTCGGATATTGGACTGTCTGCATCGGGATCCGACGGTCTAGATG
ATCATTACAATATTATAGCTGGATATTAACTAGGACTGCGTAGGTACACGCCGGTGGCTTTCCAGAAGTAGTCGAACAGTATCACATTACCCCGAACAACACCAACGGCGCAGTCGACTT
GGACAGCACCCGGGCGGTATTTGATTCTGCGGTAGTGCATGAGTACATCGATAACACAGGGGCTAGAGGTGGTCCGCTCGTGACTAGCTTCAATGAGACAAGCAGGTCCGATCTGCGACT
GTATGAGAGCGACAGCAACAAGACTATGCTTGAGCTATACGCGCAGGGAGATGAATTCCAGGACACTTGCGTTAACTTGTTGAGTCGCATGCTCAACACCGTTCCCTCCAGTGTACAACT
TCAGCCTGCAATTACGCCAGCGCTCCTCAAGCCGATTAACGTGACTTGGGATGTCACCAGCGACAACCAGCTAGTCCTCTCTGGAAAGATAAGG
GTATGTGATATAATACTCATCGGCAT
GTGGAATCCATGGCCACCATAACTAAGAAATAATCAGGTGCTATACGCCGGGGAAGTATTGGCCGACCCAGTCTCAATCACCTTCTCAAATGGTCATACGGAGACCCTGTTTCCTGAAGA
GAGCTTGGGTATCTCTGCGTTTAAACTTGCCGGTAGCCAAACCAACGCTACCGCACAATACTCGCCTTTCTCAATCCCTAGCACTAGCTTATCAGGAACGTCGTCCTTCACTGTCGCGGC
AACGGGATTCGAAGCCCAAACCTTCCAGATTCAAGACAAAGCTTTCATTGTCCCAAGCCTGACTAGTGTCGCGGACGGCAAGGTGTCCGTCACGGTCGCAGTGAGGACTAATCAGCCCGA
CTTCGATACATCTCAAGTATCTGTGAAGGTTGCAACTCCAATTGCGCAGCCGCTTACTCTTGCGCCTAAGATCGTCCGGGCTAACGTACAACTCGAGGAAGGCCAGAGCCCATTGACGAA
TATTAGTTACTGGACTGGATCGACTATAATTGTGAATCCTACTGGCGCCGTCAGTGTGACCTTACTCTCTGGTGAGGATGTCATCGACACCCTATTGCTTGGTGCAGGCGTTGCAGGTTG
GTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTACTATCCGAGCCCCGCAGCATCGGCCCTAGAGCACATTCTAGTGGACAATTGGGGCGCATACGCCTCTAATTTCTCATCCGCTATAACGCCCTGCGAAAACTACGTTACCGAA
GTAGGCTTGCCGGCCATCAACTCCCGCAGGACGACGGCTGCACAATGGCTACGGGTTGCTTTCCACGACTTCGCTACCGCCGACGTCGCAGCTGGCACCGGCGGTGTGGATGCCAGTATC
GGGTTTGAGACTGAGCGCGAGGAAAACTCCGGCACCGCATTCAATGACAGCTTCACATTCTGGCAGCCCTTCGTTAATGAGTTCGTTCCTA
TGGCGGATCTGCTTGCCGTCGGAACGGTG
ATGTCTGTTCATCTATGTGGGGGCAAGTACATACCGTACCAGTATGGCAGGGTAGACGCGACGGAAGCCGATCCGAAGACTGGTGTGCCGGAGCCGAGCACGAGCGTGGAGGAGACGCTC
GCCCAGTTTGAGCAAGCCGGCTTCAATCAATCGGATGCCATTGCCTTGACTGCATGTGGTCACACCATGGGATCC
GTACACGCCGGTGGCTTTCCAGAAGTAGTCGAACAGTATCACATT
ACCCCGAACAACACCAACGGCGCAGTCGACTTGGACAGCACCCGGGCGGTATTTGATTCTGCGGTAGTGCATGAGTACATCGATAACACAGGGGCTAGAGGTGGTCCGCTCGTGACTAGC
TTCAATGAGACAAGCAGGTCCGATCTGCGACTGTATGAGAGCGACAGCAACAAGACTATGCTTGAGCTATACGCGCAGGGAGATGAATTCCAGGACACTTGCGTTAACTTGTTGAGTCGC
ATGCTCAACACCGTTCCCTCCAGTGTACAACTTCAGCCTGCAATTACGCCAGCGCTCCTCAAGCCGATTAACGTGACTTGGGATGTCACCAGCGACAACCAGCTAGTCCTCTCTGGAAAG
ATAAGG
AGCTTGGGTATCTCTGCGTTTAAACTTGCCGGTAGCCAAACCAACGCTACCGCACAATACTCGCCTTTCTCAATCCCTAGCACTAGCTTATCAGGAACGTCGTCCTTCACTGTC
GCGGCAACGGGATTCGAAGCCCAAACCTTCCAGATTCAAGACAAAGCTTTCATTGTCCCAAGCCTGACTAGTGTCGCGGACGGCAAGGTGTCCGTCACGGTCGCAGTGAGGACTAATCAG
CCCGACTTCGATACATCTCAAGTATCTGTGAAGGTTGCAACTCCAATTGCGCAGCCGCTTACTCTTGCGCCTAAGATCGTCCGGGCTAACGTACAACTCGAGGAAGGCCAGAGCCCATTG
ACGAATATTAGTTACTGGACTGGATCGACTATAATTGTGAATCCTACTGGCGCCGTCAGTGTGACCTTACTCTCTGGTGAGGATGTCATCGACACCCTATTGCTTGGTGCAGGCGTTGCA
GGTTGGTGA

Retrieve as FASTA