Entry information : HCO27APx-CcP02
Entry ID 11943
Creation 2013-05-28 (Nizar Fawal)
Last sequence changes 2013-05-28 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-25 (Catherine Mathe (Scipio))
Peroxidase information: HCO27APx-CcP02
Name HCO27APx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. CO27-5    [TaxId: 1001938 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HCO27APx-CcP02
start..stop
S start..stop
HEC38APx-CcP02 1059 0 1..550 1..551
HC14APx-CcP03 887 0 1..550 1..550
ElaAPx-CcP1 471 2e-162 26..515 21..506
TatAPx-CcP02 470 1e-161 24..549 22..548
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 238276..238938 663 N° 2 238164..238222 59 N° 3 237809..238103 295 N° 4 237387..237749 363
N° 5 237060..237332 273  
complement(join(237060..237332,237387..237749,237809..238103,238164..238222,2382 76..238938))


exon

Literature and cross-references HCO27APx-CcP02
DNA ref. JGI genome:   scaffold_28 (238938..237060)
Cluster/Prediction ref. JGI gene:   29467
Protein sequence: HCO27APx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   551 (526)
PWM (Da):   %s   59769.36 (57243.0) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.4 (4.40) Peptide Signal:   %s   cut: 25 range:25-550
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSISSSWAILIIVLAIIANGVVAAYTWPDAQIDQLESILYQHSGYRQYGLAFGVSPCNNMANALETGRDDSAEWFRTAYHDMATADVLAGIGGIDASIGFETDRPENKGKAFNESVSFFTAFQSARSSMADVIALGALFSVGSCSNGEVIIPFRGGRRDALGSGPTGVPQPEEDLDTHTAAFARQGFNVTEMIGLVACGHTIGGVHGENFPEIVPVVNDMNNQASRQDFDGSFDNFDNSVAKQFVANTTQNPLAFGHNETTRSDFRIFNADGGNLIRRMAESQQFFWDTCTTLLERMLNTVPKDVQLTDVIQPIQIKPNNLFITVNSNGTETVSGEVIIEDGTTFSNREVLIHLKSRTGEAVPSSPILARTQDGMQVYAFYNNMPNFTFYSFTTTVPTGIGVSSFDVQIKDGDTDTTSTNGGQGFPIQDVLIVQQASTCTRLEFPSTKSNNTLEITVAVRDDMEFDSVRLVVPKPVNMIGTLSLRFEPTAVDLGKVQTLDGTGYSLYKGSFSFLVDAVGPMKTFDLVASGPKGVVQNNFTRWAEFNFC*

Retrieve as FASTA  
Remarks complete sequence from genomics (4 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACATCCATATCTAGTTCCTGGGCGATACTTATTATAGTGCTCGCTATAATTGCGAATGGTGTGGTCGCCGCATATACATGGCCAGACGCTCAGATAGACCAGCTCGAAAGTATCCTC
TATCAGCACAGTGGCTACCGCCAGTATGGACTAGCCTTCGGCGTCTCGCCCTGCAATAACATGGCAAATGCGCTGGAAACGGGTCGCGACGACTCAGCGGAATGGTTCCGCACAGCATAT
CACGATATGGCGACAGCAGACGTGCTAGCTGGAATTGGTGGAATAGACGCATCAATCGGATTTGAAACAGACCGGCCAGAGAATAAGGGCAAAGCATTTAACGAATCAGTTAGTTTCTTC
ACCGCCTTCCAGAGCGCTCGATCCTCCATGGCAGACGTGATAGCTCTCGGGGCCCTGTTTTCGGTTGGGTCGTGCTCGAATGGAGAAGTAATCATCCCTTTCCGTGGCGGGAGGCGGGAC
GCCCTTGGTTCGGGCCCAACAGGAGTGCCACAGCCGGAAGAAGATTTAGACACCCATACGGCTGCATTTGCCAGACAAGGATTCAATGTCACGGAGATGATCGGACTAGTGGCTTGTGGT
CATACAATTGGCGGTGTCCACGGAGAGAACTTCCCGGAAATCGTTCCTGTGGTGAACGATATG
GTGAGCCGAGGAATAGGGGTATAAAAAGGGGCTATGCTAACACAGAGACGCAGAATA
ATCAAGCGAGCCGTCAAGACTTTGATGGATCGTTCGATAACTTTGATAATAGCGT
GTAAGTTATGGTGACCGACTAGAAAAATGTTCCATAAAGCTCCGAGCTGACTGTAAGCAGTGCCA
AACAATTCGTGGCTAATACCACGCAGAATCCTTTGGCGTTTGGACATAACGAAACGACTAGGTCCGACTTCCGCATCTTCAACGCGGATGGCGGTAACTTGATTAGGCGCATGGCGGAAT
CGCAACAGTTCTTCTGGGACACGTGTACCACGCTACTAGAGCGGATGCTCAACACTGTCCCAAAAGATGTCCAGTTAACGGATGTCATCCAACCGATTCAAATTAAGCCCAATAATCTGT
TCATCACGGTTAACTCCAATGGAACCGAGACAGTATCAGGAGAGGTTCGG
GTAAGGAGTTTGCGACTGGTCCCTTTTGTGATGAATTGAAATGACTTACAGGAGAACAGATAATAGAAGA
CGGCACAACATTTAGCAACCGTGAGGTTTTAATTCATTTGAAATCTAGAACTGGTGAAGCGGTCCCCTCCAGCCCAATTCTAGCGCGAACACAAGACGGCATGCAGGTGTACGCTTTCTA
TAATAACATGCCAAACTTTACATTCTACTCTTTCACCACTACCGTGCCTACTGGGATTGGGGTATCCTCCTTCGATGTGCAAATCAAGGACGGTGACACGGATACAACCAGCACGAACGG
TGGCCAGGGCTTCCCTATACAGGACGTTCTTATCGTACAACAAGCAAGTACATGTACCAGACTTGAGTTTCCCAGCACGAAGTCCAACAACACGTTAGAAATAACCGTAGCT
GTCAGCCT
CATCCCGTATCTGTTCTTTGTTATACTACTCTAACCCTCATTGAAGGTCCGCGACGATATGGAATTCGACTCAGTACGGTTAGTGGTGCCGAAGCCGGTCAACATGATCGGTACGTTATC
ATTGCGCTTCGAGCCGACGGCGGTTGATTTAGGAAAAGTTCAGACGTTGGACGGAACCGGATACTCGCTGTACAAGGGTTCGTTCTCATTTTTAGTAGATGCAGTCGGCCCGATGAAGAC
GTTTGACCTGGTTGCTTCGGGGCCGAAGGGTGTTGTGCAGAATAATTTCACAAGATGGGCCGAGTTCAACTTTTGTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACATCCATATCTAGTTCCTGGGCGATACTTATTATAGTGCTCGCTATAATTGCGAATGGTGTGGTCGCCGCATATACATGGCCAGACGCTCAGATAGACCAGCTCGAAAGTATCCTC
TATCAGCACAGTGGCTACCGCCAGTATGGACTAGCCTTCGGCGTCTCGCCCTGCAATAACATGGCAAATGCGCTGGAAACGGGTCGCGACGACTCAGCGGAATGGTTCCGCACAGCATAT
CACGATATGGCGACAGCAGACGTGCTAGCTGGAATTGGTGGAATAGACGCATCAATCGGATTTGAAACAGACCGGCCAGAGAATAAGGGCAAAGCATTTAACGAATCAGTTAGTTTCTTC
ACCGCCTTCCAGAGCGCTCGATCCTCCATGGCAGACGTGATAGCTCTCGGGGCCCTGTTTTCGGTTGGGTCGTGCTCGAATGGAGAAGTAATCATCCCTTTCCGTGGCGGGAGGCGGGAC
GCCCTTGGTTCGGGCCCAACAGGAGTGCCACAGCCGGAAGAAGATTTAGACACCCATACGGCTGCATTTGCCAGACAAGGATTCAATGTCACGGAGATGATCGGACTAGTGGCTTGTGGT
CATACAATTGGCGGTGTCCACGGAGAGAACTTCCCGGAAATCGTTCCTGTGGTGAACGATATG
AATAATCAAGCGAGCCGTCAAGACTTTGATGGATCGTTCGATAACTTTGATAATAGC
GT
TGCCAAACAATTCGTGGCTAATACCACGCAGAATCCTTTGGCGTTTGGACATAACGAAACGACTAGGTCCGACTTCCGCATCTTCAACGCGGATGGCGGTAACTTGATTAGGCGCATG
GCGGAATCGCAACAGTTCTTCTGGGACACGTGTACCACGCTACTAGAGCGGATGCTCAACACTGTCCCAAAAGATGTCCAGTTAACGGATGTCATCCAACCGATTCAAATTAAGCCCAAT
AATCTGTTCATCACGGTTAACTCCAATGGAACCGAGACAGTATCAGGAGAGGTTCGG
ATAATAGAAGACGGCACAACATTTAGCAACCGTGAGGTTTTAATTCATTTGAAATCTAGAACT
GGTGAAGCGGTCCCCTCCAGCCCAATTCTAGCGCGAACACAAGACGGCATGCAGGTGTACGCTTTCTATAATAACATGCCAAACTTTACATTCTACTCTTTCACCACTACCGTGCCTACT
GGGATTGGGGTATCCTCCTTCGATGTGCAAATCAAGGACGGTGACACGGATACAACCAGCACGAACGGTGGCCAGGGCTTCCCTATACAGGACGTTCTTATCGTACAACAAGCAAGTACA
TGTACCAGACTTGAGTTTCCCAGCACGAAGTCCAACAACACGTTAGAAATAACCGTAGCT
GTCCGCGACGATATGGAATTCGACTCAGTACGGTTAGTGGTGCCGAAGCCGGTCAACATG
ATCGGTACGTTATCATTGCGCTTCGAGCCGACGGCGGTTGATTTAGGAAAAGTTCAGACGTTGGACGGAACCGGATACTCGCTGTACAAGGGTTCGTTCTCATTTTTAGTAGATGCAGTC
GGCCCGATGAAGACGTTTGACCTGGTTGCTTCGGGGCCGAAGGGTGTTGTGCAGAATAATTTCACAAGATGGGCCGAGTTCAACTTTTGTTAG

Retrieve as FASTA