Entry information : HCO27APx-CcP03
Entry ID 11944
Creation 2013-05-28 (Nizar Fawal)
Last sequence changes 2013-05-28 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-07-25 (Catherine Mathe (Scipio))
Peroxidase information: HCO27APx-CcP03
Name HCO27APx-CcP03
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Fungi/Metazoa; Fungi; Ascomycota; Ascomycota
Organism Hypoxylon sp. CO27-5    [TaxId: 1001938 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HCO27APx-CcP03
start..stop
S start..stop
HEC38APx-CcP03 1521 0 1..827 1..809
HC14APx-CcP04 1355 0 1..826 1..828
HC14APx-CcP04 132 4e-32 591..720 703..830
XhypAPx-CcP01 1076 0 1..813 1..795
XhypAPx-CcP01 169 1e-43 612..810 820..1010
DescAPx-CcP02 922 0 14..545 4..535
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 99490..100632 1143 N° 2 99243..99431 189 N° 3 98537..99188 652 N° 4 97982..98478 497
complement(join(97982..98478,98537..99188,99243..99431,99490..100632))


exon

Literature and cross-references HCO27APx-CcP03
DNA ref. JGI genome:   scaffold_134 (100632..97982)
Cluster/Prediction ref. JGI gene:   23894
Protein sequence: HCO27APx-CcP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   828 (807)
PWM (Da):   %s   87315.39 (85004.2)  
PI (pH):   %s   4.24 (4.19) Peptide Signal:   %s   cut: 21 range:21-827
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHWAVVYWGAILSLGTVARTDPTWPSSNDELEEIMYQVKGYRGRNFGGTVIPCSNEASGPGRQNAAEWLRAAFHDMATTTDLGGVRSGGLDGSLQYELTSSDNLGPGFNTTLKFMADYYTSRSGVADLIALGVYYAVRSCGGPVVPVAGGRVDAVAGGPIGVPLPQNTAFTFEQQFIRMGFNRTEMIQVTACGHSIGGVHEDEFPEIVPVGSTSNGEAPLDSTVATFDNKIITEYIDGNTTNPMVVGPSVKATRNADFKVFSYDGNVTVKAMSGATDFNNICATVLQKMIETVPDGVILSDPIEPYFVKPVDMQLALSSGATTMQLTGFIRVRTTELGGDSISSLTLNYKDRSGGENCGSAICEYTATLLGATQGFDDQFVWFPIDASISTSTGISSFTLTLNMASGTTQTFDNNGNSYPMQDAILIQKPQSCLLSGTLTVTAAVRNDRKSLPVNMFLSYKTPTGNPNLPVPTLKNATVAMTEAICVGSYTFYTANYTGLGDLAYATKIDVISGSGTSARTDDFNAASDLGGTCQAFQDPPSSLCTTGQASTPPDSSTTSSVGSTSSSSAITDITTSTSSSLPISSSTTVTSTSTSTAPTETLHHRQNLGEYVLVGCQKESTVVGGRALSGASFAYDSMTLESCLKNCTGYIYWGTEYGRECYCGDSLHSTSEDVPLTDCNMVCGGDPTEYCGDSNRIELYSTTASQPAPTATLALKPTVSSYVRVGCYTEIQNGRALTGATYAYDAMTLEMCASNCTGFAYWGTEYSRECYCGNTLDSGSTLVADADCNMVCGGDHYEYCGAGMRLELYQLVTASTSLAAITSSP

Retrieve as FASTA  
Remarks complete sequence from genomics (3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTGGGCCGTTGTGTACTGGGGCGCCATACTGTCCTTGGGTACTGTCGCGAGGACAGACCCAACCTGGCCCTCCTCTAATGACGAGCTCGAGGAGATTATGTACCAAGTTAAGGGT
TACAGGGGAAGAAATTTTGGCGGTACCGTCATACCATGCTCCAATGAAGCATCCGGACCCGGTCGACAAAACGCTGCGGAGTGGTTACGAGCAGCGTTCCATGATATGGCCACAACTACT
GATTTGGGTGGCGTGCGATCCGGTGGGCTGGACGGCTCTTTGCAGTATGAGTTGACCAGCTCAGACAACCTCGGTCCAGGCTTCAACACGACTCTCAAATTCATGGCCGACTATTATACC
AGTCGATCAGGCGTAGCGGATCTCATTGCTCTGGGAGTATACTATGCCGTGAGGTCTTGCGGTGGCCCTGTGGTACCAGTAGCCGGTGGAAGGGTCGACGCTGTGGCAGGTGGTCCTATA
GGTGTCCCGCTACCACAGAACACTGCCTTCACCTTTGAACAACAATTTATTCGGATGGGCTTCAACAGGACCGAGATGATTCAAGTCACCGCCTGCGGTCATTCTATTGGTGGTGTTCAC
GAAGATGAATTTCCAGAGATTGTCCCGGTTGGATCTACTTCAAACGGCGAGGCCCCCTTGGACTCGACTGTCGCTACCTTCGATAACAAGATCATCACCGAATACATTGATGGCAACACG
ACTAATCCCATGGTGGTTGGGCCATCTGTCAAGGCTACTAGGAATGCGGACTTCAAGGTGTTCAGTTACGATGGAAATGTGACCGTCAAAGCCATGTCAGGTGCTACGGACTTCAATAAT
ATATGCGCTACTGTTCTTCAGAAGATGATTGAAACAGTGCCCGACGGCGTAATTCTGTCGGACCCCATCGAGCCATATTTTGTCAAGCCAGTTGATATGCAGTTGGCGCTAAGCTCTGGT
GCTACTACAATGCAATTGACAGGCTTTATACGCGTTCGAACAACAGAATTGGGTGGAGATTCAATCTCGAGCTTGACGTTAAATTACAAAGACAGAAGTGGAGGTGAAAACTGCGGTAGC
GCAATTTGCGAATATACAGCAACTCTTTTGGGTGCCACTCAGGGCTTCGATGATCAATTTGTT
GTAAGTATGAGGAACAGCTTGTGGTTATCTTAACCAGTCGAGACCTGACATATCTAA
GTGGTTTCCTATCGATGCTTCCATCTCGACTTCCACGGGCATTTCATCTTTCACTCTGACCCTCAACATGGCTAGTGGAACGACTCAAACATTTGATAACAATGGAAATTCGTACCCCAT
GCAAGACGCAATTTTGATTCAAAAGCCCCAGAGTTGTCTTCTTTCCGGCACTCTTACAGTCACAGCAGCT
GTGAGCCATACCTTACAAGCTGAACCACAGGCAACTGTTGACATGTTTCT
TTAGGTTCGAAATGATCGAAAATCTCTCCCTGTTAACATGTTTCTTTCCTACAAGACCCCAACGGGAAACCCGAATCTTCCGGTGCCTACTCTTAAAAACGCAACGGTCGCTATGACCGA
AGCGATTTGTGTAGGCTCATATACATTTTATACTGCCAATTACACAGGTCTTGGCGATCTTGCGTATGCAACTAAAATCGACGTTATTAGCGGAAGTGGCACCTCGGCTCGAACAGACGA
TTTCAACGCCGCCAGCGACTTGGGAGGTACTTGTCAGGCTTTCCAAGATCCACCGTCATCTTTGTGTACCACCGGACAGGCGTCGACGCCTCCCGATTCCTCAACCACATCGTCTGTGGG
AAGCACTTCTTCGTCATCAGCCATCACGGATATCACTACGTCGACTTCGTCATCACTGCCTATTAGCTCATCTACCACGGTGACCAGCACAAGCACCTCTACAGCACCGACAGAGACCTT
GCACCACAGACAGAACCTTGGTGAGTATGTGCTTGTAGGGTGCCAGAAAGAGTCGACTGTGGTAGGAGGTCGCGCTCTTAGCGGTGCATCATTCGCCTATGATAGTATGACGCTGGAGAG
TTGTTTGAAGAATTGTACAGGATATATCTACTGGGGTACCGAGTATGGCAGAGAGT
GTGAGCTTTTAAACCCGCGGACGTCGTTAGCAAGAGATGCGGCTAACTTTCCATGTAGGTTACT
GTGGCGATTCGCTCCACTCAACAAGCGAAGATGTGCCCTTGACCGACTGTAATATGGTCTGCGGCGGAGACCCTACCGAATACTGCGGAGATAGTAATAGAATAGAGTTATACAGCACTA
CAGCCAGCCAGCCAGCCCCGACCGCCACACTGGCTCTTAAGCCAACTGTGTCATCGTACGTCCGTGTCGGTTGCTATACCGAAATACAGAATGGCCGTGCCCTGACCGGGGCAACTTATG
CGTACGACGCTATGACATTGGAAATGTGTGCTTCAAACTGCACAGGCTTTGCGTATTGGGGAACGGAATATAGCCGAGAATGCTACTGCGGTAATACTCTGGATAGTGGCAGCACACTTG
TTGCCGATGCTGATTGTAACATGGTTTGTGGTGGGGACCATTATGAGTACTGCGGAGCTGGAATGAGGCTTGAATTATACCAGCTAGTAACAGCTTCGACATCTCTGGCAGCTATCACTT
CGAGTCCCGTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTGGGCCGTTGTGTACTGGGGCGCCATACTGTCCTTGGGTACTGTCGCGAGGACAGACCCAACCTGGCCCTCCTCTAATGACGAGCTCGAGGAGATTATGTACCAAGTTAAGGGT
TACAGGGGAAGAAATTTTGGCGGTACCGTCATACCATGCTCCAATGAAGCATCCGGACCCGGTCGACAAAACGCTGCGGAGTGGTTACGAGCAGCGTTCCATGATATGGCCACAACTACT
GATTTGGGTGGCGTGCGATCCGGTGGGCTGGACGGCTCTTTGCAGTATGAGTTGACCAGCTCAGACAACCTCGGTCCAGGCTTCAACACGACTCTCAAATTCATGGCCGACTATTATACC
AGTCGATCAGGCGTAGCGGATCTCATTGCTCTGGGAGTATACTATGCCGTGAGGTCTTGCGGTGGCCCTGTGGTACCAGTAGCCGGTGGAAGGGTCGACGCTGTGGCAGGTGGTCCTATA
GGTGTCCCGCTACCACAGAACACTGCCTTCACCTTTGAACAACAATTTATTCGGATGGGCTTCAACAGGACCGAGATGATTCAAGTCACCGCCTGCGGTCATTCTATTGGTGGTGTTCAC
GAAGATGAATTTCCAGAGATTGTCCCGGTTGGATCTACTTCAAACGGCGAGGCCCCCTTGGACTCGACTGTCGCTACCTTCGATAACAAGATCATCACCGAATACATTGATGGCAACACG
ACTAATCCCATGGTGGTTGGGCCATCTGTCAAGGCTACTAGGAATGCGGACTTCAAGGTGTTCAGTTACGATGGAAATGTGACCGTCAAAGCCATGTCAGGTGCTACGGACTTCAATAAT
ATATGCGCTACTGTTCTTCAGAAGATGATTGAAACAGTGCCCGACGGCGTAATTCTGTCGGACCCCATCGAGCCATATTTTGTCAAGCCAGTTGATATGCAGTTGGCGCTAAGCTCTGGT
GCTACTACAATGCAATTGACAGGCTTTATACGCGTTCGAACAACAGAATTGGGTGGAGATTCAATCTCGAGCTTGACGTTAAATTACAAAGACAGAAGTGGAGGTGAAAACTGCGGTAGC
GCAATTTGCGAATATACAGCAACTCTTTTGGGTGCCACTCAGGGCTTCGATGATCAATTTGTT
TGGTTTCCTATCGATGCTTCCATCTCGACTTCCACGGGCATTTCATCTTTCACTCTG
ACCCTCAACATGGCTAGTGGAACGACTCAAACATTTGATAACAATGGAAATTCGTACCCCATGCAAGACGCAATTTTGATTCAAAAGCCCCAGAGTTGTCTTCTTTCCGGCACTCTTACA
GTCACAGCAGCT
GTTCGAAATGATCGAAAATCTCTCCCTGTTAACATGTTTCTTTCCTACAAGACCCCAACGGGAAACCCGAATCTTCCGGTGCCTACTCTTAAAAACGCAACGGTCGCT
ATGACCGAAGCGATTTGTGTAGGCTCATATACATTTTATACTGCCAATTACACAGGTCTTGGCGATCTTGCGTATGCAACTAAAATCGACGTTATTAGCGGAAGTGGCACCTCGGCTCGA
ACAGACGATTTCAACGCCGCCAGCGACTTGGGAGGTACTTGTCAGGCTTTCCAAGATCCACCGTCATCTTTGTGTACCACCGGACAGGCGTCGACGCCTCCCGATTCCTCAACCACATCG
TCTGTGGGAAGCACTTCTTCGTCATCAGCCATCACGGATATCACTACGTCGACTTCGTCATCACTGCCTATTAGCTCATCTACCACGGTGACCAGCACAAGCACCTCTACAGCACCGACA
GAGACCTTGCACCACAGACAGAACCTTGGTGAGTATGTGCTTGTAGGGTGCCAGAAAGAGTCGACTGTGGTAGGAGGTCGCGCTCTTAGCGGTGCATCATTCGCCTATGATAGTATGACG
CTGGAGAGTTGTTTGAAGAATTGTACAGGATATATCTACTGGGGTACCGAGTATGGCAGAGAGT
GTTACTGTGGCGATTCGCTCCACTCAACAAGCGAAGATGTGCCCTTGACCGACTGT
AATATGGTCTGCGGCGGAGACCCTACCGAATACTGCGGAGATAGTAATAGAATAGAGTTATACAGCACTACAGCCAGCCAGCCAGCCCCGACCGCCACACTGGCTCTTAAGCCAACTGTG
TCATCGTACGTCCGTGTCGGTTGCTATACCGAAATACAGAATGGCCGTGCCCTGACCGGGGCAACTTATGCGTACGACGCTATGACATTGGAAATGTGTGCTTCAAACTGCACAGGCTTT
GCGTATTGGGGAACGGAATATAGCCGAGAATGCTACTGCGGTAATACTCTGGATAGTGGCAGCACACTTGTTGCCGATGCTGATTGTAACATGGTTTGTGGTGGGGACCATTATGAGTAC
TGCGGAGCTGGAATGAGGCTTGAATTATACCAGCTAGTAACAGCTTCGACATCTCTGGCAGCTATCACTTCGAGTCCCGTT

Retrieve as FASTA