Entry information : TharCP02
Entry ID 11966
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-06-24 (Catherine Mathe (Scipio))
Peroxidase information: TharCP02
Name TharCP02
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma harzianum    [TaxId: 5544 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TharCP02
start..stop
S start..stop
TviCP02 1474 0 1..793 1..793
HjCP02 1452 0 1..793 1..792
TatCP02 1394 0 1..793 1..794
TaspCP01 1390 0 1..793 1..795
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 708578..708902 325 N° 2 708969..709196 228 N° 3 709273..709857 585 N° 4 709923..710165 243
N° 5 710234..710559 326 N° 6 710625..710814 190 N° 7 710886..711370 485  
join(708578..708902,708969..709196,709273..709857,709923..710165,710234..710559, 710625..710814,710886..711370)


exon

Literature and cross-references TharCP02
DNA ref. JGI genome:   scaffold_13 (708578..711370)
Cluster/Prediction ref. JGI gene:   523580
Protein sequence: TharCP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   794 (775)
PWM (Da):   %s   85464.8 (83528.7)  
PI (pH):   %s   5.72 (5.56) Peptide Signal:   %s   cut: 19 range:19-793
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPLKNILAIVGALPLASAAGCPHINGNSNVHVARSGFQHPESILETRFSPDGPDFGTCPRKSTVAGGGTRSRQWWPCELNLAVLRQFSEKSNPFGSDFDYASAFSKIDVTQLKKDITAVQTTSQDWWPADFGNYGPFFIRLAWHNAGTYRAVDGRGGAGQGQQRFAPLNSWPDNANLDKARRLLWPIKQKYGAALSWADLFVFAGNTAMENMGFPTYGFGFGRVDTWQSDEGIYWGGEQEMFPEALNNVVRYNGSTDFTTRADELESPLGAVSMGLIYVDPRGPNGTPDTKASALDIRETFGRMGMDDEETVALIAGGHAFGKTHGAVAGSNVGPEPNAAGIELQGLGWKNSFGTGNADDAYTSGLEVIWSRTPTKWANEFLFSLLNNNFTLTKSPDGAPQWEALDANASYPDPFIPGKFRRPTMLTSDLGLRDDPIYNNISKTFLNDFDYFTEKFGLAWYKLLHRDMGPISRYLGPEIPKQAPLIWQDPLPAPAYTTLAASDVSSLKSQILAAPGLNISNLVTTAWGSASTFRISDKRGGANGARIALQPQASFAANNPTRLAAVIKALKGVQTKFQSSGKKVSLADLIVLGGAAAIEKAAKAAGVTVTVPFTPGRVDATQDQTDVSTFAFLQPQADGFRNFGHGTASSLTEELLVDKAALLTLSPPELTVLIGGFRALSANFDGSSTGILTSRPGTLTNDFFVNLLGSYATWSVVNGTNEELFQSTNSAGKVQWTASRADLIFGSHPELRAISEVYGSSDGQSKFVTDFIAAWSKVMDLDRYDVKGHSGPY*

Retrieve as FASTA  
Remarks complete sequence from genomics (6 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCTCAAGAACATCTTGGCCATTGTCGGCGCACTGCCGCTGGCCTCTGCCGCCGGCTGCCCTCACATCAACGGCAACAGCAACGTCCACGTTGCCCGCAGTGGCTTTCAACACCCC
GAGTCCATCTTGGAGACGAGATTCAGCCCCGATGGCCCTGATTTCGGAACCTGCCCCCGCAAGAGCACTGTTGCTGGTGGCGGCACTCGAAGCAGGCAGTGGTGGCCTTGCGAGCTGAAC
TTGGCTGTTCTTCGCCAGTTCTCTGAGAAGTCCAACCCCTTTGGCTCTGACTTCGACTATGCTAGCGCCTTCTCCAAGATCGATG
GTGAGTTTATTGCTCCTTTCAATGCTTAACCTTGC
TAGTTAGTGCTCATGCTGATATACGAAACAGTCACCCAGCTGAAGAAGGACATCACCGCCGTCCAGACCACCTCTCAGGACTGGTGGCCTGCCGACTTTGGCAACTATGGTCCCTTCTTC
ATCCGTCTTGCTTGGCACAACGCTGGTACCTACCGCGCCGTTGATGGACGCGGAGGTGCCGGTCAGGGCCAGCAGCGTTTTGCTCCCCTCAACAGCTGGCCTGACAATGCCAACCTTGAC
AAGGCTCGCCGCCTGCTTT
GTAAGTTGATCCCCAACGCTAAAGCCAGAAACGGCACGCAATGATCGAATTGAGCAATGGTACTAACCAGGTACAGGGCCCATCAAGCAAAAGTATGGTGC
TGCTCTCTCCTGGGCTGATCTGTTTGTCTTCGCCGGTAACACTGCCATGGAGAACATGGGCTTCCCCACGTATGGCTTCGGCTTTGGACGTGTGGATACCTGGCAGTCCGACGAGGGCAT
CTACTGGGGTGGCGAGCAGGAGATGTTCCCTGAGGCTCTCAACAACGTGGTCCGTTACAACGGAAGCACTGACTTCACGACTCGTGCGGATGAACTCGAGAGCCCGCTTGGAGCCGTCAG
CATGGGTCTCATCTACGTTGACCCCCGCGGACCCAATGGTACCCCTGACACCAAGGCCTCTGCCCTTGATATCCGTGAGACCTTCGGCCGCATGGGTATGGATGATGAAGAGACCGTTGC
TCTGATTGCTGGCGGTCACGCCTTTGGCAAGACCCACGGTGCCGTTGCTGGATCCAACGTCGGTCCCGAGCCCAACGCTGCTGGCATTGAGCTCCAGGGTCTTGGCTGGAAGAACAGCTT
TGGCACTGGCAACGCTGATGATGCCTACACCAGTGGTCTCGAGGTCATTTGGTCTCGTACTCCCACTAAGTGGGCCAACG
GTGAGTATTTTGCAGCATCCCTTCTGGTGATCGACAACTA
GGACACACGCTAATGCTTCTAACAGAGTTCCTCTTCTCCCTGCTCAACAACAACTTCACCCTCACCAAGTCCCCCGATGGTGCTCCTCAGTGGGAGGCTCTCGATGCCAACGCCTCCTAC
CCCGACCCCTTCATCCCTGGCAAGTTCCGTCGCCCTACGATGCTTACCAGTGATCTTGGTCTCCGTGATGACCCCATCTACAACAACATCTCCAAGACCTTCCTCAACGACTTTGACTAC
TTCACCGAGAAGTTCGGTCTTGCCTGGT
GTAAGTGCCTAACCTCCCTGGTGACATATCTGGGGAAATGACAGGAGGCCTAACTGAGTTCGATATAGACAAGCTTCTCCACCGTGACATGG
GCCCCATCTCCCGCTACCTTGGCCCTGAGATCCCCAAGCAGGCTCCTCTCATCTGGCAGGATCCTCTTCCCGCTCCCGCTTACACCACTCTGGCCGCGTCTGATGTCTCATCCCTGAAGT
CGCAGATTCTCGCTGCTCCCGGCCTCAACATCTCCAACCTGGTCACCACCGCTTGGGGATCTGCTTCCACCTTCCGTATCTCTGACAAGCGTGGTGGTGCCAACGGAGCTCGCATTGCTC
TCCAGCCCCAGGCCTCTTTCGCCGCCAACAACCCCACTCGTCTGGCTGCTGTCATCAAGGCT
GTAAGTGAAGATACTATTTCTATCGATGCTGAACAAGCAATTTGCTAATACAATTTCA
CCTACAGCTCAAGGGAGTCCAGACCAAGTTCCAGTCCAGCGGCAAGAAGGTTTCTCTGGCTGATCTCATCGTTCTCGGTGGTGCTGCTGCCATTGAGAAGGCTGCCAAGGCTGCCGGGGT
CACTGTCACCGTGCCTTTCACCCCTGGTCGTGTTGATGCCACCCAAGATCAGACCGATGTCTCCACTTTCGCTTTCC
GTAAGTCTATCCTCTTACGGTAATCATAACGTTGCCTGCATGA
TTGGATGCTGACCGTTTTTGTGCTATAGTCCAACCCCAGGCTGATGGTTTCCGTAACTTTGGCCACGGCACTGCTTCATCCCTCACTGAGGAGCTTCTGGTTGACAAGGCCGCTCTCCTG
ACCCTGAGCCCTCCTGAGCTGACTGTCCTCATTGGTGGTTTCCGTGCCCTCTCTGCCAACTTCGACGGCTCCTCCACTGGTATCCTCACCTCCCGCCCTGGCACTCTCACCAACGACTTC
TTCGTCAACCTGTTGGGCTCATACGCCACCTGGTCCGTTGTCAACGGCACCAACGAGGAGCTCTTCCAGAGCACCAACTCTGCCGGCAAGGTTCAGTGGACTGCTTCCCGTGCTGATCTC
ATCTTCGGCTCTCACCCCGAGCTCCGTGCCATCTCTGAGGTCTACGGTTCTTCCGATGGACAGAGCAAGTTTGTCACCGACTTCATCGCTGCTTGGTCCAAGGTCATGGACCTCGACCGT
TATGATGTTAAGGGACACTCTGGTCCTTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCTCAAGAACATCTTGGCCATTGTCGGCGCACTGCCGCTGGCCTCTGCCGCCGGCTGCCCTCACATCAACGGCAACAGCAACGTCCACGTTGCCCGCAGTGGCTTTCAACACCCC
GAGTCCATCTTGGAGACGAGATTCAGCCCCGATGGCCCTGATTTCGGAACCTGCCCCCGCAAGAGCACTGTTGCTGGTGGCGGCACTCGAAGCAGGCAGTGGTGGCCTTGCGAGCTGAAC
TTGGCTGTTCTTCGCCAGTTCTCTGAGAAGTCCAACCCCTTTGGCTCTGACTTCGACTATGCTAGCGCCTTCTCCAAGATCGATG
TCACCCAGCTGAAGAAGGACATCACCGCCGTCCAG
ACCACCTCTCAGGACTGGTGGCCTGCCGACTTTGGCAACTATGGTCCCTTCTTCATCCGTCTTGCTTGGCACAACGCTGGTACCTACCGCGCCGTTGATGGACGCGGAGGTGCCGGTCAG
GGCCAGCAGCGTTTTGCTCCCCTCAACAGCTGGCCTGACAATGCCAACCTTGACAAGGCTCGCCGCCTGCTTT
GGCCCATCAAGCAAAAGTATGGTGCTGCTCTCTCCTGGGCTGATCTG
TTTGTCTTCGCCGGTAACACTGCCATGGAGAACATGGGCTTCCCCACGTATGGCTTCGGCTTTGGACGTGTGGATACCTGGCAGTCCGACGAGGGCATCTACTGGGGTGGCGAGCAGGAG
ATGTTCCCTGAGGCTCTCAACAACGTGGTCCGTTACAACGGAAGCACTGACTTCACGACTCGTGCGGATGAACTCGAGAGCCCGCTTGGAGCCGTCAGCATGGGTCTCATCTACGTTGAC
CCCCGCGGACCCAATGGTACCCCTGACACCAAGGCCTCTGCCCTTGATATCCGTGAGACCTTCGGCCGCATGGGTATGGATGATGAAGAGACCGTTGCTCTGATTGCTGGCGGTCACGCC
TTTGGCAAGACCCACGGTGCCGTTGCTGGATCCAACGTCGGTCCCGAGCCCAACGCTGCTGGCATTGAGCTCCAGGGTCTTGGCTGGAAGAACAGCTTTGGCACTGGCAACGCTGATGAT
GCCTACACCAGTGGTCTCGAGGTCATTTGGTCTCGTACTCCCACTAAGTGGGCCAACG
AGTTCCTCTTCTCCCTGCTCAACAACAACTTCACCCTCACCAAGTCCCCCGATGGTGCTCCT
CAGTGGGAGGCTCTCGATGCCAACGCCTCCTACCCCGACCCCTTCATCCCTGGCAAGTTCCGTCGCCCTACGATGCTTACCAGTGATCTTGGTCTCCGTGATGACCCCATCTACAACAAC
ATCTCCAAGACCTTCCTCAACGACTTTGACTACTTCACCGAGAAGTTCGGTCTTGCCTGGT
ACAAGCTTCTCCACCGTGACATGGGCCCCATCTCCCGCTACCTTGGCCCTGAGATCCCC
AAGCAGGCTCCTCTCATCTGGCAGGATCCTCTTCCCGCTCCCGCTTACACCACTCTGGCCGCGTCTGATGTCTCATCCCTGAAGTCGCAGATTCTCGCTGCTCCCGGCCTCAACATCTCC
AACCTGGTCACCACCGCTTGGGGATCTGCTTCCACCTTCCGTATCTCTGACAAGCGTGGTGGTGCCAACGGAGCTCGCATTGCTCTCCAGCCCCAGGCCTCTTTCGCCGCCAACAACCCC
ACTCGTCTGGCTGCTGTCATCAAGGCT
CTCAAGGGAGTCCAGACCAAGTTCCAGTCCAGCGGCAAGAAGGTTTCTCTGGCTGATCTCATCGTTCTCGGTGGTGCTGCTGCCATTGAGAAG
GCTGCCAAGGCTGCCGGGGTCACTGTCACCGTGCCTTTCACCCCTGGTCGTGTTGATGCCACCCAAGATCAGACCGATGTCTCCACTTTCGCTTTCC
TCCAACCCCAGGCTGATGGTTTC
CGTAACTTTGGCCACGGCACTGCTTCATCCCTCACTGAGGAGCTTCTGGTTGACAAGGCCGCTCTCCTGACCCTGAGCCCTCCTGAGCTGACTGTCCTCATTGGTGGTTTCCGTGCCCTC
TCTGCCAACTTCGACGGCTCCTCCACTGGTATCCTCACCTCCCGCCCTGGCACTCTCACCAACGACTTCTTCGTCAACCTGTTGGGCTCATACGCCACCTGGTCCGTTGTCAACGGCACC
AACGAGGAGCTCTTCCAGAGCACCAACTCTGCCGGCAAGGTTCAGTGGACTGCTTCCCGTGCTGATCTCATCTTCGGCTCTCACCCCGAGCTCCGTGCCATCTCTGAGGTCTACGGTTCT
TCCGATGGACAGAGCAAGTTTGTCACCGACTTCATCGCTGCTTGGTCCAAGGTCATGGACCTCGACCGTTATGATGTTAAGGGACACTCTGGTCCTTACTAG

Retrieve as FASTA