Entry information : TharAPx-CcP01
Entry ID 11967
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-06-24 (Catherine Mathe (Scipio))
Peroxidase information: TharAPx-CcP01
Name TharAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma harzianum    [TaxId: 5544 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TharAPx-CcP01
start..stop
S start..stop
TviAPx-CcP02 673 0 1..549 1..539
TharAPx-CcP03 671 0 1..549 1..556
HjAPx-CcP02 667 0 1..547 1..551
TatAPx-CcP02 655 0 1..550 1..550
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 27626..28288 663 N° 2 27485..27546 62 N° 3 27106..27400 295 N° 4 26683..27045 363
N° 5 26340..26609 270  
complement(join(26340..26609,26683..27045,27106..27400,27485..27546,27626..28288 ))


exon

Literature and cross-references TharAPx-CcP01
DNA ref. JGI genome:   scaffold_17 (28288..26340)
Cluster/Prediction ref. JGI gene:   486527
Protein sequence: TharAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   551 (528)
PWM (Da):   %s   58541.88 (55991.6)  
PI (pH):   %s   4.41 (4.37) Peptide Signal:   %s   cut: 23 range:23-550
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAWTKTIAYTLATCSLWLPTNADNVWPNEATDELEKMLFEQQNPFESSLATFAVPCSASGLAIGRGFGAEWIRNAYHDMATADVQAGTGGIDASIVFEKDRPENPGAGFQETLDFFRPRYTTRSSLADLFAMGAVFGVGGCSNGNIILPYRAGRVDATGPGPSGVPEPQEDLATHTAKFVRQGFNTTEMIALVACGHTVGGVHGVDFPEIVPNPQPPPVTGPFGNDNTVFFDTTTSNFDNQVAKEFVANISQNPLAFGHNETTRSDFRIFNADGGDMISRMAESLDFFSQTCATLLERMINTVPPSVKLTDVLQPLPVKPRKWSIDVNADKTLTVSLTLIVDTLLGGGIQALVKPVSRTGAALPATSPVVIGNISTSTCDYPNCGPSFVYLDYNINIPAEQGISSFTVDITDGTGKTTTYNNGGAGFPLSDAVQPQMSLSTQTTKTVNGVTLQQLNVTAAVYNADQYTNISLIVPQPSNFSATISPWVAEVAPMKASGKIAGTNYTLYTGSWLASDESAPQHPFDVLATGPKGSASSTFNSWGDVPFVL*

Retrieve as FASTA  
Remarks complete sequence from genomics (4 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGGACAAAGACCATTGCCTATACGCTAGCTACCTGCTCGCTCTGGCTTCCCACCAATGCCGACAATGTCTGGCCAAATGAAGCAACTGACGAGCTTGAGAAAATGTTGTTCGAA
CAACAGAACCCTTTCGAAAGCAGCCTTGCCACCTTTGCTGTTCCCTGCAGTGCCAGTGGCCTCGCCATCGGGCGTGGTTTTGGTGCTGAGTGGATCAGAAACGCATACCATGACATGGCC
ACGGCAGACGTGCAAGCTGGCACTGGAGGAATAGATGCCTCGATTGTTTTCGAAAAGGATCGCCCAGAGAATCCCGGCGCCGGTTTCCAAGAAACCTTGGACTTTTTCCGGCCAAGATAC
ACCACCCGATCCTCGTTAGCTGACCTATTCGCTATGGGGGCAGTTTTTGGAGTTGGCGGATGCTCAAATGGAAATATCATCCTCCCTTACAGGGCGGGTCGTGTTGATGCAACCGGTCCC
GGCCCTTCTGGCGTTCCAGAACCACAGGAGGACCTTGCCACACACACTGCAAAGTTCGTGAGGCAGGGTTTCAACACGACCGAGATGATTGCCCTTGTTGCCTGTGGGCATACCGTTGGA
GGTGTGCATGGTGTGGATTTTCCAGAAATCGTGCCGAACCCACAGCCCCCTCCAGTTACTGGC
GTTCGTATATCCACTCTCTTTGACCAACAGAGGCTTAGCGATTATTCATGCATGTGG
CGACTAATGTTGACTATTTTAGCCTTTCGGTAATGACAATACGGTCTTTTTTGATACGACGACCAGCAATTTCGACAACCAGGTGTAAGTCTGTCTTGGCACCTCGTGGTCAACTGACGC
TCCCCTGAACCCATCCTGTCGACAGGTAACTGATCTTTGACCAACCAGTGCCAAGGAATTTGTGGCCAATATTTCTCAGAATCCGCTTGCATTTGGCCATAATGAGACAACGCGGTCGGA
TTTCCGCATTTTCAACGCTGACGGCGGTGATATGATCTCACGAATGGCTGAATCACTAGATTTCTTCTCTCAGACCTGCGCTACTCTGTTGGAACGTATGATCAATACGGTGCCACCAAG
TGTTAAGCTAACTGATGTTCTTCAACCCCTGCCCGTTAAGCCAAGAAAGTGGTCTATAGATGTCAATGCGGATAAGACGCTGACCGTCAGTCTAACTTTAAGA
GTAAGTACTAGTAATAG
CACCAACAAGAACGGATGAGAGCTTCAGGAACTAACTTTTCAGATTGTCGACACTTTACTGGGAGGTGGCATCCAGGCCTTGGTCAAGCCAGTCTCACGCACCGGCGCGGCTTTGCCTGC
CACATCGCCTGTCGTTATTGGAAACATATCTACTTCAACCTGCGACTATCCTAACTGCGGCCCAAGCTTTGTGTATCTTGATTACAACATCAATATTCCTGCTGAACAAGGCATATCCTC
TTTTACCGTTGACATTACAGACGGCACTGGCAAGACTACGACCTATAACAATGGAGGCGCCGGATTCCCTCTATCTGATGCTGTTCAACCACAGATGAGCCTCAGCACACAAACTACGAA
AACTGTCAACGGTGTCACTCTTCAACAACTCAATGTGACTGCAGCG
GTATGATTGACTCCCATTGTGCGTCACCGTGTTCAATAAGAGTGGAGTAGCTAACAGAGTATTTATGACTCAGG
TTTACAATGCTGACCAGTATACTAACATCTCGCTTATCGTTCCTCAGCCTTCCAACTTCAGTGCTACCATAAGCCCATGGGTTGCGGAGGTAGCCCCCATGAAGGCTTCCGGCAAGATTG
CAGGGACCAACTACACTCTCTATACCGGCTCGTGGTTGGCCAGCGACGAGAGTGCCCCTCAACATCCTTTCGATGTTCTTGCCACAGGTCCAAAGGGCAGTGCTTCAAGCACATTTAACT
CGTGGGGTGATGTGCCATTCGTTCTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGGACAAAGACCATTGCCTATACGCTAGCTACCTGCTCGCTCTGGCTTCCCACCAATGCCGACAATGTCTGGCCAAATGAAGCAACTGACGAGCTTGAGAAAATGTTGTTCGAA
CAACAGAACCCTTTCGAAAGCAGCCTTGCCACCTTTGCTGTTCCCTGCAGTGCCAGTGGCCTCGCCATCGGGCGTGGTTTTGGTGCTGAGTGGATCAGAAACGCATACCATGACATGGCC
ACGGCAGACGTGCAAGCTGGCACTGGAGGAATAGATGCCTCGATTGTTTTCGAAAAGGATCGCCCAGAGAATCCCGGCGCCGGTTTCCAAGAAACCTTGGACTTTTTCCGGCCAAGATAC
ACCACCCGATCCTCGTTAGCTGACCTATTCGCTATGGGGGCAGTTTTTGGAGTTGGCGGATGCTCAAATGGAAATATCATCCTCCCTTACAGGGCGGGTCGTGTTGATGCAACCGGTCCC
GGCCCTTCTGGCGTTCCAGAACCACAGGAGGACCTTGCCACACACACTGCAAAGTTCGTGAGGCAGGGTTTCAACACGACCGAGATGATTGCCCTTGTTGCCTGTGGGCATACCGTTGGA
GGTGTGCATGGTGTGGATTTTCCAGAAATCGTGCCGAACCCACAGCCCCCTCCAGTTACTGGC
CCTTTCGGTAATGACAATACGGTCTTTTTTGATACGACGACCAGCAATTTCGACAAC
CAGGT
TGCCAAGGAATTTGTGGCCAATATTTCTCAGAATCCGCTTGCATTTGGCCATAATGAGACAACGCGGTCGGATTTCCGCATTTTCAACGCTGACGGCGGTGATATGATCTCACGA
ATGGCTGAATCACTAGATTTCTTCTCTCAGACCTGCGCTACTCTGTTGGAACGTATGATCAATACGGTGCCACCAAGTGTTAAGCTAACTGATGTTCTTCAACCCCTGCCCGTTAAGCCA
AGAAAGTGGTCTATAGATGTCAATGCGGATAAGACGCTGACCGTCAGTCTAACTTTAAGA
ATTGTCGACACTTTACTGGGAGGTGGCATCCAGGCCTTGGTCAAGCCAGTCTCACGCACC
GGCGCGGCTTTGCCTGCCACATCGCCTGTCGTTATTGGAAACATATCTACTTCAACCTGCGACTATCCTAACTGCGGCCCAAGCTTTGTGTATCTTGATTACAACATCAATATTCCTGCT
GAACAAGGCATATCCTCTTTTACCGTTGACATTACAGACGGCACTGGCAAGACTACGACCTATAACAATGGAGGCGCCGGATTCCCTCTATCTGATGCTGTTCAACCACAGATGAGCCTC
AGCACACAAACTACGAAAACTGTCAACGGTGTCACTCTTCAACAACTCAATGTGACTGCAGCG
GTTTACAATGCTGACCAGTATACTAACATCTCGCTTATCGTTCCTCAGCCTTCCAAC
TTCAGTGCTACCATAAGCCCATGGGTTGCGGAGGTAGCCCCCATGAAGGCTTCCGGCAAGATTGCAGGGACCAACTACACTCTCTATACCGGCTCGTGGTTGGCCAGCGACGAGAGTGCC
CCTCAACATCCTTTCGATGTTCTTGCCACAGGTCCAAAGGGCAGTGCTTCAAGCACATTTAACTCGTGGGGTGATGTGCCATTCGTTCTCTAA

Retrieve as FASTA