Entry information : TharAPx-CcP02
Entry ID 11968
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-06-24 (Catherine Mathe (Scipio))
Peroxidase information: TharAPx-CcP02
Name TharAPx-CcP02
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma harzianum    [TaxId: 5544 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TharAPx-CcP02
start..stop
S start..stop
TviAPx-CcP01 1651 0 1..931 1..909
TaspAPx-CcP01 1566 0 1..931 1..912
TatAPx-CcP01 1556 0 1..931 1..922
HjAPx-CcP01 1550 0 1..932 1..924
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 458253..460254 2002 N° 2 460317..461113 797  
join(458253..460254,460317..461113)


exon

Literature and cross-references TharAPx-CcP02
DNA ref. JGI genome:   scaffold_9 (458253..461113)
Cluster/Prediction ref. JGI gene:   496976
Protein sequence: TharAPx-CcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   933 (913)
PWM (Da):   %s   97444.99 (95591.0)  
PI (pH):   %s   4.11 (4.09) Peptide Signal:   %s   cut: 20 range:20-932
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSTAALVGLLGLAGSALADPTWPNAVDEIEEIMTQLQSFRARKFADTVNPCSNEASGPGRQNAAEWLRVGFHDMSTANINFGIGGLDASLQYELDDGENTGPGHRTTLEFMAPYLSPRSSLADLIALGVYTSVRSCGGPAVPIRVGRIDATGKGPTGVPQPQNSVFTFQQQFQRMGFSTQEMIQVTACGHTLGGVHNTEFPDIVPAGTGLDGEAGLDSSDAVFDNKVVTEYLSGETQNPLVVGPSVKISKNSDFKVFNSDNNQTMEALADADTFTSVCKTVLQKMIEVVPPGVTFSDPIVPYNVKPVNLQLTLANGGTTLQFTGFIRVKTTGLAKGSISSVTITYKNRKGTTDCGLSSCVITATALGTSQGFDDTFDFFPFTANILASSGISSFTVTINNADGTKDIHDNNGNEYPVQDAIIFQAPQSCVLGSSGALTAVAAVRNDRLSQGAQAKIWFKTPQTTSPVPLLQSTTVDLQKGQCVGSYTFFNIDTTIQGGLAYEAYVDVINGDQSDSFKSLANIGGTCRAFASPAACNGGDDGSGGTTGLPTIPATTTDAVPTTSEPATSEPATSEPATSEPATSEPATSGPVTTAPPTTTAPPTTTAVPTPTHKPSVDGYVLVSCWTEGDGVRALAGNSYANDTMTLETCRDFCSSYVYWGTEYGRECYCGNTLAKSSEAAPIDQCNMVCGGDGSEFCGAGNRLELYSTTVTQPPTPTGTLTHEPTVGAYTLVGCWTEGQGDRALGQAATQAADMTNEACAEFCSDYRYFGTEYGDECYCGSFLSTSSSTAPLADCNMPCGGNQFEYCGASNRLELYINANVTGGEPEQPAAAGDFVFVGCQTEGNGTRALTGAATATGTMSDEACADFCADFTYFGTEYGSECYCGNILAPSSLKAPASDCNMLCSGNELEYCGAGNRLSLYTKKPTELTE

Retrieve as FASTA  
Remarks complete sequence from genomics (1 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCAACAGCTGCCCTGGTGGGCCTCCTCGGCCTGGCTGGCTCAGCCCTGGCTGATCCCACATGGCCCAACGCAGTCGACGAGATTGAGGAGATCATGACCCAGCTCCAGTCGTTC
CGCGCCCGTAAATTCGCCGATACCGTCAACCCATGCTCCAATGAAGCCTCGGGGCCCGGCCGGCAGAACGCCGCTGAGTGGCTCCGGGTCGGCTTCCACGACATGTCCACTGCCAACATC
AACTTCGGCATTGGTGGTCTAGACGCCTCGCTCCAGTACGAGCTGGACGATGGCGAAAACACCGGGCCCGGCCACAGGACGACACTCGAGTTCATGGCTCCCTATCTCTCTCCCCGGTCC
AGCTTGGCTGACCTCATCGCCCTGGGCGTCTACACATCTGTCCGCTCTTGCGGCGGCCCTGCTGTGCCAATTCGTGTTGGCCGTATCGATGCCACCGGCAAGGGACCTACAGGCGTTCCC
CAGCCCCAAAACTCTGTCTTCACCTTTCAGCAGCAGTTTCAGCGCATGGGCTTCAGCACTCAGGAAATGATCCAAGTCACCGCCTGTGGTCACACTCTTGGTGGCGTCCACAACACTGAG
TTCCCCGATATCGTTCCCGCCGGAACTGGGCTCGATGGCGAAGCTGGTCTTGATAGCTCCGATGCCGTCTTCGATAACAAGGTCGTGACTGAGTATCTCTCCGGAGAGACCCAGAATCCT
CTTGTTGTCGGCCCATCCGTCAAGATTAGCAAAAACTCCGACTTCAAGGTTTTCAATTCCGATAACAACCAGACCATGGAGGCCTTGGCCGATGCTGATACCTTTACCTCTGTCTGCAAG
ACCGTTCTGCAAAAGATGATTGAGGTTGTCCCTCCGGGCGTCACCTTCTCTGACCCGATTGTGCCTTACAACGTCAAGCCGGTCAACTTGCAGCTGACTCTTGCCAATGGCGGCACCACT
CTCCAGTTTACGGGCTTCATCCGTGTCAAGACCACCGGCCTTGCCAAGGGCAGCATCTCCAGCGTGACCATCACTTACAAGAACCGCAAGGGCACCACCGACTGCGGCCTCAGCTCTTGT
GTCATCACTGCCACGGCTCTAGGCACCAGCCAAGGCTTTGATGATACCTTTGACTTCTTCCCCTTCACGGCCAACATCCTTGCCTCTTCGGGTATCTCATCCTTCACCGTCACTATCAAC
AACGCCGACGGTACCAAGGACATCCACGACAACAACGGAAATGAGTACCCTGTCCAGGATGCCATCATCTTCCAGGCTCCCCAGAGCTGTGTGCTGGGATCTTCGGGTGCTCTGACTGCT
GTCGCTGCCGTCCGCAACGATCGCCTGAGCCAGGGTGCGCAAGCTAAAATCTGGTTCAAGACTCCCCAGACCACCAGCCCCGTTCCTCTCTTGCAGAGCACTACCGTCGACCTCCAGAAG
GGTCAGTGTGTTGGGTCCTACACTTTCTTCAACATTGATACCACCATCCAGGGTGGTCTGGCCTACGAGGCATATGTCGATGTCATCAACGGCGACCAGTCTGACAGCTTCAAGTCTCTC
GCCAACATTGGCGGTACTTGCCGTGCCTTTGCTAGCCCGGCTGCCTGCAACGGAGGAGATGATGGATCCGGTGGCACAACGGGCCTCCCAACCATCCCAGCTACTACCACCGATGCCGTA
CCAACTACTTCCGAGCCTGCTACCAGTGAGCCCGCTACCAGTGAACCTGCCACGAGTGAACCTGCCACTAGCGAACCTGCTACCAGCGGCCCCGTCACCACTGCGCCTCCGACAACAACA
GCGCCGCCCACAACTACTGCAGTTCCCACTCCTACCCACAAGCCGTCAGTTGATGGTTATGTCCTTGTTTCTTGCTGGACCGAAGGCGATGGCGTTCGTGCGCTTGCTGGCAATTCCTAC
GCCAATGACACGATGACTCTGGAAACCTGCAGAGACTTTTGCAGCAGCTATGTCTACTGGGGTACCGAATATGGCCGCGAAT
GTGAGTATTCCATCCCTACACGTTCTTTGAATTACATT
TGTGCTAACCAATGTGTGACTCAGGTTATTGCGGTAACACGCTTGCCAAGAGCAGTGAGGCGGCCCCCATTGATCAGTGCAACATGGTCTGCGGTGGTGATGGTAGTGAATTCTGTGGTG
CCGGCAACCGTCTTGAGCTGTACTCAACCACCGTCACCCAGCCTCCCACTCCCACAGGTACCCTTACTCACGAGCCCACCGTTGGTGCCTACACGTTGGTGGGCTGCTGGACGGAAGGTC
AGGGCGACCGCGCTCTGGGCCAGGCAGCTACCCAGGCAGCTGACATGACCAATGAGGCTTGCGCCGAGTTCTGTTCCGACTACAGATACTTTGGTACTGAGTATGGTGACGAATGCTACT
GTGGAAGCTTCCTTTCCACTTCGAGCTCAACCGCTCCCCTTGCCGACTGCAACATGCCCTGCGGTGGTAACCAGTTTGAGTACTGCGGAGCCAGCAACCGCCTTGAGCTTTACATCAACG
CCAATGTTACTGGCGGAGAGCCTGAACAACCTGCTGCTGCTGGTGACTTTGTGTTTGTCGGCTGCCAGACAGAGGGCAACGGCACCCGTGCCCTGACCGGCGCTGCCACTGCAACAGGTA
CCATGTCCGATGAGGCCTGTGCCGACTTCTGTGCCGACTTTACGTACTTTGGTACTGAATACGGCAGCGAATGCTACTGCGGCAATATCCTGGCTCCTTCATCTCTGAAGGCTCCGGCGT
CTGACTGCAACATGCTTTGCAGCGGCAACGAGCTCGAGTACTGTGGTGCGGGCAACCGCCTGTCGCTGTACACTAAGAAGCCTACTGAGCTTACTGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCAACAGCTGCCCTGGTGGGCCTCCTCGGCCTGGCTGGCTCAGCCCTGGCTGATCCCACATGGCCCAACGCAGTCGACGAGATTGAGGAGATCATGACCCAGCTCCAGTCGTTC
CGCGCCCGTAAATTCGCCGATACCGTCAACCCATGCTCCAATGAAGCCTCGGGGCCCGGCCGGCAGAACGCCGCTGAGTGGCTCCGGGTCGGCTTCCACGACATGTCCACTGCCAACATC
AACTTCGGCATTGGTGGTCTAGACGCCTCGCTCCAGTACGAGCTGGACGATGGCGAAAACACCGGGCCCGGCCACAGGACGACACTCGAGTTCATGGCTCCCTATCTCTCTCCCCGGTCC
AGCTTGGCTGACCTCATCGCCCTGGGCGTCTACACATCTGTCCGCTCTTGCGGCGGCCCTGCTGTGCCAATTCGTGTTGGCCGTATCGATGCCACCGGCAAGGGACCTACAGGCGTTCCC
CAGCCCCAAAACTCTGTCTTCACCTTTCAGCAGCAGTTTCAGCGCATGGGCTTCAGCACTCAGGAAATGATCCAAGTCACCGCCTGTGGTCACACTCTTGGTGGCGTCCACAACACTGAG
TTCCCCGATATCGTTCCCGCCGGAACTGGGCTCGATGGCGAAGCTGGTCTTGATAGCTCCGATGCCGTCTTCGATAACAAGGTCGTGACTGAGTATCTCTCCGGAGAGACCCAGAATCCT
CTTGTTGTCGGCCCATCCGTCAAGATTAGCAAAAACTCCGACTTCAAGGTTTTCAATTCCGATAACAACCAGACCATGGAGGCCTTGGCCGATGCTGATACCTTTACCTCTGTCTGCAAG
ACCGTTCTGCAAAAGATGATTGAGGTTGTCCCTCCGGGCGTCACCTTCTCTGACCCGATTGTGCCTTACAACGTCAAGCCGGTCAACTTGCAGCTGACTCTTGCCAATGGCGGCACCACT
CTCCAGTTTACGGGCTTCATCCGTGTCAAGACCACCGGCCTTGCCAAGGGCAGCATCTCCAGCGTGACCATCACTTACAAGAACCGCAAGGGCACCACCGACTGCGGCCTCAGCTCTTGT
GTCATCACTGCCACGGCTCTAGGCACCAGCCAAGGCTTTGATGATACCTTTGACTTCTTCCCCTTCACGGCCAACATCCTTGCCTCTTCGGGTATCTCATCCTTCACCGTCACTATCAAC
AACGCCGACGGTACCAAGGACATCCACGACAACAACGGAAATGAGTACCCTGTCCAGGATGCCATCATCTTCCAGGCTCCCCAGAGCTGTGTGCTGGGATCTTCGGGTGCTCTGACTGCT
GTCGCTGCCGTCCGCAACGATCGCCTGAGCCAGGGTGCGCAAGCTAAAATCTGGTTCAAGACTCCCCAGACCACCAGCCCCGTTCCTCTCTTGCAGAGCACTACCGTCGACCTCCAGAAG
GGTCAGTGTGTTGGGTCCTACACTTTCTTCAACATTGATACCACCATCCAGGGTGGTCTGGCCTACGAGGCATATGTCGATGTCATCAACGGCGACCAGTCTGACAGCTTCAAGTCTCTC
GCCAACATTGGCGGTACTTGCCGTGCCTTTGCTAGCCCGGCTGCCTGCAACGGAGGAGATGATGGATCCGGTGGCACAACGGGCCTCCCAACCATCCCAGCTACTACCACCGATGCCGTA
CCAACTACTTCCGAGCCTGCTACCAGTGAGCCCGCTACCAGTGAACCTGCCACGAGTGAACCTGCCACTAGCGAACCTGCTACCAGCGGCCCCGTCACCACTGCGCCTCCGACAACAACA
GCGCCGCCCACAACTACTGCAGTTCCCACTCCTACCCACAAGCCGTCAGTTGATGGTTATGTCCTTGTTTCTTGCTGGACCGAAGGCGATGGCGTTCGTGCGCTTGCTGGCAATTCCTAC
GCCAATGACACGATGACTCTGGAAACCTGCAGAGACTTTTGCAGCAGCTATGTCTACTGGGGTACCGAATATGGCCGCGAAT
GTTATTGCGGTAACACGCTTGCCAAGAGCAGTGAGGCG
GCCCCCATTGATCAGTGCAACATGGTCTGCGGTGGTGATGGTAGTGAATTCTGTGGTGCCGGCAACCGTCTTGAGCTGTACTCAACCACCGTCACCCAGCCTCCCACTCCCACAGGTACC
CTTACTCACGAGCCCACCGTTGGTGCCTACACGTTGGTGGGCTGCTGGACGGAAGGTCAGGGCGACCGCGCTCTGGGCCAGGCAGCTACCCAGGCAGCTGACATGACCAATGAGGCTTGC
GCCGAGTTCTGTTCCGACTACAGATACTTTGGTACTGAGTATGGTGACGAATGCTACTGTGGAAGCTTCCTTTCCACTTCGAGCTCAACCGCTCCCCTTGCCGACTGCAACATGCCCTGC
GGTGGTAACCAGTTTGAGTACTGCGGAGCCAGCAACCGCCTTGAGCTTTACATCAACGCCAATGTTACTGGCGGAGAGCCTGAACAACCTGCTGCTGCTGGTGACTTTGTGTTTGTCGGC
TGCCAGACAGAGGGCAACGGCACCCGTGCCCTGACCGGCGCTGCCACTGCAACAGGTACCATGTCCGATGAGGCCTGTGCCGACTTCTGTGCCGACTTTACGTACTTTGGTACTGAATAC
GGCAGCGAATGCTACTGCGGCAATATCCTGGCTCCTTCATCTCTGAAGGCTCCGGCGTCTGACTGCAACATGCTTTGCAGCGGCAACGAGCTCGAGTACTGTGGTGCGGGCAACCGCCTG
TCGCTGTACACTAAGAAGCCTACTGAGCTTACTGAGTAG

Retrieve as FASTA