Entry information : TharAPx-CcP03
Entry ID 11969
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-06-24 (Catherine Mathe (Scipio))
Peroxidase information: TharAPx-CcP03
Name TharAPx-CcP03
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma harzianum    [TaxId: 5544 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TharAPx-CcP03
start..stop
S start..stop
TviAPx-CcP02 914 0 1..556 1..539
HjAPx-CcP02 847 0 1..553 1..550
TaspAPx-CcP03 714 0 1..553 1..547
TatAPx-CcP02 704 0 1..556 1..549
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 693584..694309 726 N° 2 694450..694755 306 N° 3 694834..695199 366 N° 4 695266..695538 273
join(693584..694309,694450..694755,694834..695199,695266..695538)


exon

Literature and cross-references TharAPx-CcP03
DNA ref. JGI genome:   scaffold_16 (693584..695538)
Cluster/Prediction ref. JGI gene:   524430
Protein sequence: TharAPx-CcP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   557 (534)
PWM (Da):   %s   59239.15 (56661.8)  
PI (pH):   %s   4.44 (4.36) Peptide Signal:   %s   cut: 23 range:23-556
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAWTRAVAYAVLSSQFWLPTKADYIWPNAQIDELEREVFEQENPFDGPGSTVSFVDGCSGPAERALGIGRSFGAEWIRNAYHDMATADVSAGTGGLDASIVFEMDRSENVGDAFRETLGIFQGSYNTRASMADLFAIGAVMAVGACSNGKVIVPFRGGRVDAAGPGPSGVPEPQQDLPTHTLSFAKQGFDTSEMIALVACGHSVGGVHGVDFPEIVPNPVPTNDVRNSTSLTDGGLVNYHDSLTASAKEFVANVSQNPLAFGQNETTRSDFRIFNADGGDMISQMASSNDFFLNTCTTMFERMINTVPRDVKLTDVIKPLKIKPRKLSVTVNDDQTLSISGFIRIVDDLIGANGTQVLIHLASRSGEALPVATGTTSQGLTASCGYPNCGPSYTYFRFSSTIPAEQGVSSFTVEIIDGSTGKATVFNNGGSGFPVSDAILPMFSLSSQSRITINGSDELQLNLTAAVLNAEMYANVSLIVPQPSNKTAPIGPWTQEIVHMEPLSKISGTNFTLYRGIWQSSGPLTAISSHPFDLVAQGSTKTVSSLFNSWDDVEFV*

Retrieve as FASTA  
Remarks complete sequence from genomics (3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTGGACTCGAGCGGTTGCGTATGCTGTTTTAAGCTCGCAATTCTGGCTTCCCACCAAGGCTGATTACATTTGGCCGAATGCGCAGATCGATGAGCTTGAGAGAGAAGTATTCGAA
CAGGAAAACCCCTTTGACGGTCCCGGCAGCACTGTTTCTTTTGTGGACGGATGCAGTGGGCCAGCTGAGCGTGCGCTTGGTATAGGGCGTAGTTTTGGTGCTGAATGGATTAGAAACGCC
TATCACGACATGGCAACAGCAGATGTGTCTGCTGGAACAGGTGGCCTTGACGCTTCAATTGTTTTCGAGATGGATCGTTCTGAGAACGTTGGAGATGCATTTCGGGAAACACTTGGCATT
TTTCAGGGCAGCTATAATACTCGAGCGTCTATGGCTGATTTATTTGCCATAGGCGCTGTGATGGCTGTTGGCGCGTGTTCAAATGGAAAGGTCATTGTTCCATTTAGAGGCGGTCGCGTG
GACGCAGCTGGCCCAGGTCCATCTGGTGTTCCGGAGCCTCAGCAAGACCTACCTACACATACTCTCAGTTTTGCGAAACAGGGATTTGATACATCTGAAATGATCGCACTCGTTGCTTGT
GGGCATAGTGTTGGAGGTGTGCATGGTGTGGACTTTCCAGAAATTGTCCCTAATCCTGTGCCAACGAATGATGTTCGTAATTCTACGTCTCTGACCGACGGCGGGTTGGTGAATTATCAT
GACTCG
GTTGACTAACTTCAAGACAACCTTTTAGGCAACGAACGATAATACCGTTACTTTTGATACAACGACGGACAACTTTGACAACCTTGTGTTAGTTTTGCTCTTGCGTCGCCCTGT
CTGAACTCCACCAAACTAACGTCTAGCTTACTGCCAGTGCCAAAGAGTTCGTCGCCAATGTTTCCCAAAACCCACTTGCGTTTGGACAAAATGAAACAACACGATCGGACTTTCGTATTT
TCAACGCAGATGGCGGCGATATGATTTCACAGATGGCGTCGTCCAATGACTTTTTCCTGAACACGTGCACCACTATGTTTGAGCGCATGATCAATACAGTGCCGAGAGATGTTAAATTGA
CAGATGTTATTAAACCTCTTAAGATCAAGCCTCGAAAGTTGTCTGTTACAGTTAACGATGACCAAACGCTCTCAATATCCGGATTCATACGA
GTCAGTGCTGCTCTTCTACCCGCCGCAG
AAGTTAGAGATCTTGAATGGCTAACTAATAGCAATTTGAACTTACTAAAGATTGTTGATGACCTAATTGGTGCAAATGGAACACAAGTTCTTATCCATTTAGCCTCGCGATCCGGTGAAG
CTTTGCCTGTGGCCACTGGAACGACATCACAAGGGCTGACTGCAAGCTGCGGCTATCCTAATTGCGGTCCAAGCTACACCTATTTCAGATTCAGCTCTACAATTCCCGCTGAACAGGGCG
TATCGTCTTTTACTGTCGAAATTATCGACGGCTCAACTGGAAAGGCTACAGTTTTCAACAATGGTGGCAGCGGATTCCCTGTATCTGATGCTATTCTGCCAATGTTTAGCCTTTCAAGTC
AGAGCAGGATAACCATCAATGGTAGTGACGAGTTACAACTCAATTTGACCGCAGCA
GTAAGTCCAATCCATGTATCATGCGGTAGTTCTTTTTCGCACAACTGACCATTTGACACCGATA
AGGTTCTCAATGCGGAGATGTATGCAAACGTTTCACTCATTGTTCCGCAACCCTCAAATAAAACCGCTCCAATTGGCCCATGGACTCAGGAAATAGTTCATATGGAGCCTTTGAGCAAAA
TTTCTGGAACCAATTTTACACTCTACAGAGGCATATGGCAGAGCAGTGGTCCATTGACAGCAATCTCTTCGCACCCTTTCGATCTTGTTGCTCAGGGATCGACAAAAACAGTTTCTAGTC
TCTTCAACTCCTGGGATGATGTTGAATTTGTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTGGACTCGAGCGGTTGCGTATGCTGTTTTAAGCTCGCAATTCTGGCTTCCCACCAAGGCTGATTACATTTGGCCGAATGCGCAGATCGATGAGCTTGAGAGAGAAGTATTCGAA
CAGGAAAACCCCTTTGACGGTCCCGGCAGCACTGTTTCTTTTGTGGACGGATGCAGTGGGCCAGCTGAGCGTGCGCTTGGTATAGGGCGTAGTTTTGGTGCTGAATGGATTAGAAACGCC
TATCACGACATGGCAACAGCAGATGTGTCTGCTGGAACAGGTGGCCTTGACGCTTCAATTGTTTTCGAGATGGATCGTTCTGAGAACGTTGGAGATGCATTTCGGGAAACACTTGGCATT
TTTCAGGGCAGCTATAATACTCGAGCGTCTATGGCTGATTTATTTGCCATAGGCGCTGTGATGGCTGTTGGCGCGTGTTCAAATGGAAAGGTCATTGTTCCATTTAGAGGCGGTCGCGTG
GACGCAGCTGGCCCAGGTCCATCTGGTGTTCCGGAGCCTCAGCAAGACCTACCTACACATACTCTCAGTTTTGCGAAACAGGGATTTGATACATCTGAAATGATCGCACTCGTTGCTTGT
GGGCATAGTGTTGGAGGTGTGCATGGTGTGGACTTTCCAGAAATTGTCCCTAATCCTGTGCCAACGAATGATGTTCGTAATTCTACGTCTCTGACCGACGGCGGGTTGGTGAATTATCAT
GACTCG
CTTACTGCCAGTGCCAAAGAGTTCGTCGCCAATGTTTCCCAAAACCCACTTGCGTTTGGACAAAATGAAACAACACGATCGGACTTTCGTATTTTCAACGCAGATGGCGGCGAT
ATGATTTCACAGATGGCGTCGTCCAATGACTTTTTCCTGAACACGTGCACCACTATGTTTGAGCGCATGATCAATACAGTGCCGAGAGATGTTAAATTGACAGATGTTATTAAACCTCTT
AAGATCAAGCCTCGAAAGTTGTCTGTTACAGTTAACGATGACCAAACGCTCTCAATATCCGGATTCATACGA
ATTGTTGATGACCTAATTGGTGCAAATGGAACACAAGTTCTTATCCAT
TTAGCCTCGCGATCCGGTGAAGCTTTGCCTGTGGCCACTGGAACGACATCACAAGGGCTGACTGCAAGCTGCGGCTATCCTAATTGCGGTCCAAGCTACACCTATTTCAGATTCAGCTCT
ACAATTCCCGCTGAACAGGGCGTATCGTCTTTTACTGTCGAAATTATCGACGGCTCAACTGGAAAGGCTACAGTTTTCAACAATGGTGGCAGCGGATTCCCTGTATCTGATGCTATTCTG
CCAATGTTTAGCCTTTCAAGTCAGAGCAGGATAACCATCAATGGTAGTGACGAGTTACAACTCAATTTGACCGCAGCA
GTTCTCAATGCGGAGATGTATGCAAACGTTTCACTCATTGTT
CCGCAACCCTCAAATAAAACCGCTCCAATTGGCCCATGGACTCAGGAAATAGTTCATATGGAGCCTTTGAGCAAAATTTCTGGAACCAATTTTACACTCTACAGAGGCATATGGCAGAGC
AGTGGTCCATTGACAGCAATCTCTTCGCACCCTTTCGATCTTGTTGCTCAGGGATCGACAAAAACAGTTTCTAGTCTCTTCAACTCCTGGGATGATGTTGAATTTGTTTGA

Retrieve as FASTA