Entry information : TharAPx-CcP04
Entry ID 11970
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-06-24 (Catherine Mathe (Scipio))
Peroxidase information: TharAPx-CcP04
Name TharAPx-CcP04
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP004]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma harzianum    [TaxId: 5544 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TharAPx-CcP04
start..stop
S start..stop
TharAPx-CcP01 502 4e-174 1..561 1..550
HjAPx-CcP02 494 5e-171 1..555 1..548
TviAPx-CcP02 491 8e-170 1..555 1..534
TharAPx-CcP03 489 5e-169 1..555 1..551
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 113471..113691 221 N° 2 112914..113355 442 N° 3 112791..112846 56 N° 4 112467..112727 261
N° 5 112370..112403 34 N° 6 111891..112289 399 N° 7 111556..111828 273  
complement(join(111556..111828,111891..112289,112370..112403,112467..112727,1127 91..112846,112914..113355,113471..113691))


exon

Literature and cross-references TharAPx-CcP04
DNA ref. JGI genome:   scaffold_1 (113691..111556)
Cluster/Prediction ref. JGI gene:   72809
Protein sequence: TharAPx-CcP04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   562 (539)
PWM (Da):   %s   60675.61 (58263.3)  
PI (pH):   %s   4.39 (4.39) Peptide Signal:   %s   cut: 23 range:23-561
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFPQTALLALASVSLWSPALCEQVWPNARTDRLEWLLYEQLGGYASPGIAFFVHDCVGIGNETQGINFGAEWLRNAYHDMSTADTIAGTGGLDGSIIYELDRAENVGNAFSETRDSFSGLVTTRSSLADLFALGATFAIGACSNGTMIIPLRAGRIDAREAGPAGVPEPQQDLATHTASFARQGFNATEMIELVACGHTIGGVHGVDFPEIVPFVPNDDDDEHTSSFDTSYHFFDNKVATEFISNTTKNPLASGANVTTRSDERIFNSDGRVTMRKLAESNDYFTSRCSILLERMLNTVPKEVVLTEPIDYYPVKPRAAQIDINANGTMTFSGVIRVEDSLLTSPNTQVRLHFVPRNGSQCSDATPCSVTNGIAGNFEHATCVYTKCPATFSFFEYSLVVPSGQGASSFVVEIADGDTGASVIHDNNGNGFPTGESLQPQYKLSTQQTFLIPGPDNTFISKQQLNLTVAVLNAERFTNVTAIFYEHKIPGVNTGGWNTESVELTLSQKVEGTNFTYYTTSYARTFNDAIGPHPFDLVATGPGVSISNDFIDWNGFTSIL

Retrieve as FASTA  
Remarks complete sequence from genomics (6 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCCCACAGACTGCTCTGCTGGCTCTGGCTAGTGTTTCTCTCTGGTCCCCTGCACTCTGCGAACAAGTCTGGCCGAACGCTCGCACTGACCGTTTAGAGTGGCTATTGTACGAG
CAATTGGGTGGTTACGCTAGCCCGGGCATTGCCTTTTTTGTTCATGACTGTGTTGGCATAGGCAACGAAACCCAAGGGATAAATTTTGGGGCAGAATGGCT
GTAAGCAGTATACCGGCAG
CAACAATATGCGTTGCCTCTCGGATGTTCCTTGAGAAACAATATGGCATAGAGGCGTCTCTTTGTCTTGATCGGATTGCTGACCGGGTCTCAATAGGAGGAATGCTTACCACGACATGTC
GACAGCGGATACCATCGCTGGGACAGGAGGACTAGATGGCTCGATCATTTACGAGTTGGACCGAGCAGAGAATGTGGGCAACGCTTTCTCGGAGACACGAGATAGTTTTTCCGGCTTGGT
GACAACCAGGTCTTCCTTGGCAGACTTGTTCGCCCTCGGTGCCACCTTTGCGATTGGGGCTTGCTCCAATGGTACTATGATCATCCCCCTCCGTGCTGGAAGGATAGATGCCAGAGAAGC
GGGACCAGCGGGTGTCCCTGAACCGCAGCAAGACCTTGCCACTCACACCGCATCTTTTGCAAGGCAAGGCTTCAATGCCACTGAGATGATTGAACTTGTGGCGTGTGGACATACCATTGG
CGGTGTACATGGCGTTGATTTTCCTGAAATCGTCCCCTTTGTGCCTAATGATGATCCG
GTATGTGCTAGCTACCTAATATATTTGCGTTGTAGGAGGCGGAATACTAATCCCTTATGATG
AATAGGATGATGAGCACACCAGCAGTTTTGACACGTCATACCACTTCTTTGATAACAAGGTGTAAGTACAGCTCAGTTCTTTCTTTTAATCCGATGCATATTTCTAAATCTCCATGAAAT
GTAGGGCTACCGAGTTCATCAGCAATACAACCAAGAACCCCCTCGCATCTGGAGCGAATGTCACTACTCGATCAGATGAGCGTATTTTTAATTCGGATGGCCGTGTGACTATGAGAAAGC
TGGCTGAGTCTAACGACTACTTCACATCAAGATGCAGCATCCTACTGGAACGTATGCTGAACACAGTACCAAAGGAGGTGGTTCTCACTGAGCCCATCGACTATTACCCCGTCAAGCCTC
GAGCAGCCCAGATTGACATTAACGC
GTAAGGACAGCTATCATTGCTCCTCGTACAACTGTTAGTACCTGCTGACCAAAAGATTTGTAGCAATGGAACTATGACTTTCTCAGGGGTCATAA
GA
GTGCGTTCTGCCATAAGTACCCTAACAAGATGTTAAAAAATTGCGCTGGTCCACTAACAAATATTTGGGCTACGCCTTAGGTCGAAGATTCCTTGCTCACCAGCCCCAATACCCAAGT
CCGACTACATTTCGTTCCTCGAAATGGCTCTCAGTGCTCGGATGCGACGCCCTGCAGCGTTACCAATGGTATCGCAGGCAACTTCGAACATGCTACCTGTGTATACACAAAATGCCCTGC
AACCTTTAGTTTTTTCGAATACTCGTTAGTCGTTCCCTCTGGACAAGGCGCTTCATCCTTCGTGGTTGAGATTGCCGACGGTGACACAGGAGCTTCGGTCATCCACGACAATAACGGAAA
CGGGTTTCCTACTGGGGAGTCGCTTCAGCCCCAATACAAATTATCCACCCAGCAGACCTTTCTCATTCCCGGCCCCGACAATACATTCATCAGCAAGCAACAGCTCAACCTAACTGTGGC
G
GTTAGTAAACGTCCTGTCGAACAATAGGCTGATATAGACACAAGCTAACGCGAACTCAAAAGGTGTTGAATGCCGAGCGATTTACCAATGTTACCGCCATCTTTTACGAACACAAGATT
CCGGGGGTGAATACTGGAGGTTGGAATACAGAGTCTGTAGAGTTAACGTTGTCCCAAAAGGTCGAGGGTACCAACTTTACTTATTATACGACTTCATACGCACGTACGTTTAATGATGCT
ATAGGCCCTCACCCATTTGATCTTGTGGCAACAGGGCCGGGGGTAAGTATCTCAAATGATTTTATCGATTGGAATGGGTTTACATCGATTTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCCCACAGACTGCTCTGCTGGCTCTGGCTAGTGTTTCTCTCTGGTCCCCTGCACTCTGCGAACAAGTCTGGCCGAACGCTCGCACTGACCGTTTAGAGTGGCTATTGTACGAG
CAATTGGGTGGTTACGCTAGCCCGGGCATTGCCTTTTTTGTTCATGACTGTGTTGGCATAGGCAACGAAACCCAAGGGATAAATTTTGGGGCAGAATGGCT
GAGGAATGCTTACCACGAC
ATGTCGACAGCGGATACCATCGCTGGGACAGGAGGACTAGATGGCTCGATCATTTACGAGTTGGACCGAGCAGAGAATGTGGGCAACGCTTTCTCGGAGACACGAGATAGTTTTTCCGGC
TTGGTGACAACCAGGTCTTCCTTGGCAGACTTGTTCGCCCTCGGTGCCACCTTTGCGATTGGGGCTTGCTCCAATGGTACTATGATCATCCCCCTCCGTGCTGGAAGGATAGATGCCAGA
GAAGCGGGACCAGCGGGTGTCCCTGAACCGCAGCAAGACCTTGCCACTCACACCGCATCTTTTGCAAGGCAAGGCTTCAATGCCACTGAGATGATTGAACTTGTGGCGTGTGGACATACC
ATTGGCGGTGTACATGGCGTTGATTTTCCTGAAATCGTCCCCTTTGTGCCTAATGATGATCCG
GATGATGAGCACACCAGCAGTTTTGACACGTCATACCACTTCTTTGATAACAAGGTG
GCTACCGAGTTCATCAGCAATACAACCAAGAACCCCCTCGCATCTGGAGCGAATGTCACTACTCGATCAGATGAGCGTATTTTTAATTCGGATGGCCGTGTGACTATGAGAAAGCTGGCT
GAGTCTAACGACTACTTCACATCAAGATGCAGCATCCTACTGGAACGTATGCTGAACACAGTACCAAAGGAGGTGGTTCTCACTGAGCCCATCGACTATTACCCCGTCAAGCCTCGAGCA
GCCCAGATTGACATTAACGC
CAATGGAACTATGACTTTCTCAGGGGTCATAAGAGTCGAAGATTCCTTGCTCACCAGCCCCAATACCCAAGTCCGACTACATTTCGTTCCTCGAAATGGC
TCTCAGTGCTCGGATGCGACGCCCTGCAGCGTTACCAATGGTATCGCAGGCAACTTCGAACATGCTACCTGTGTATACACAAAATGCCCTGCAACCTTTAGTTTTTTCGAATACTCGTTA
GTCGTTCCCTCTGGACAAGGCGCTTCATCCTTCGTGGTTGAGATTGCCGACGGTGACACAGGAGCTTCGGTCATCCACGACAATAACGGAAACGGGTTTCCTACTGGGGAGTCGCTTCAG
CCCCAATACAAATTATCCACCCAGCAGACCTTTCTCATTCCCGGCCCCGACAATACATTCATCAGCAAGCAACAGCTCAACCTAACTGTGGCG
GTGTTGAATGCCGAGCGATTTACCAAT
GTTACCGCCATCTTTTACGAACACAAGATTCCGGGGGTGAATACTGGAGGTTGGAATACAGAGTCTGTAGAGTTAACGTTGTCCCAAAAGGTCGAGGGTACCAACTTTACTTATTATACG
ACTTCATACGCACGTACGTTTAATGATGCTATAGGCCCTCACCCATTTGATCTTGTGGCAACAGGGCCGGGGGTAAGTATCTCAAATGATTTTATCGATTGGAATGGGTTTACATCGATT
TTGTAA

Retrieve as FASTA