Entry information : TharAPx-CcP05
Entry ID 11971
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-06-24 (Catherine Mathe (Scipio))
Peroxidase information: TharAPx-CcP05
Name TharAPx-CcP05
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma harzianum    [TaxId: 5544 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TharAPx-CcP05
start..stop
S start..stop
TviAPx-CcP03 900 0 1..462 1..462
TatAPx-CcP03 754 0 1..462 1..461
HjAPx-CcP03 618 0 1..337 1..338
TaspAPx-CcP02 580 0 1..337 1..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 296731..297375 645 N° 2 296559..296626 68 N° 3 296213..296507 295 N° 4 295751..296146 396
complement(join(295751..296146,296213..296507,296559..296626,296731..297375))


exon

Literature and cross-references TharAPx-CcP05
DNA ref. JGI genome:   scaffold_8 (297375..295751)
Cluster/Prediction ref. JGI gene:   89133
Protein sequence: TharAPx-CcP05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   468 (444)
PWM (Da):   %s   49888.51 (47456.2)  
PI (pH):   %s   4.66 (4.54) Peptide Signal:   %s   cut: 24 range:24-467
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVLSNRFLSAVAKLGLVAGSAYAEKEQIWPANTDLLESMLFEQQGFNSQNSPATFIVPCEKVTFGTGRNGAAEWLRTAYHDMATADVENGIGGIDASIGFEVNRDENPGIGFNETLMNLAAFLTPRSSMADLIAMGALFAANGCSNGSVEIPFRAGRVDATGPGPTGVPRPEQPLDEHITSFQKQGFTPQEMIGLVACGHTLGGVHGVDFPEIVDATDDNTQTFDTTNSGFTAFDNTVAVQYVNNVTQNPLAFGHNETTRSDARIFASDGGIEIGRMATSPAYFYKTCQDLLERMINTVPKGVTLTEPLQPYPVKPSRLFATVNSNGTMSLTGYIVIGTVAANPNRSIKLHIHPRAGVTCTPAKPCTVSNNIPAFASGHVMYGNPPLTFWTYPFTVEVPLAQGISGFDVEVIDNINGVTNSTLHTNGGNGFPFDDTLLTQPQLSCTETHTEGLMNLTVAVSSHTLI*

Retrieve as FASTA  
Remarks complete sequence from genomics (3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTTGTCAAATCGTTTCCTCTCTGCCGTCGCCAAACTCGGCTTGGTAGCTGGCTCAGCTTATGCCGAGAAGGAACAAATCTGGCCAGCCAACACCGATCTCCTGGAGAGCATGCTC
TTTGAGCAACAAGGCTTCAACTCCCAAAACTCTCCTGCGACTTTTATTGTTCCTTGCGAAAAGGTTACCTTTGGCACCGGCCGTAACGGCGCCGCAGAATGGCTGCGTACAGCATATCAC
GACATGGCAACTGCGGATGTTGAGAATGGAATAGGAGGTATCGACGCGTCGATTGGATTTGAAGTCAACCGTGACGAGAACCCAGGTATTGGATTCAACGAGACGCTGATGAACCTGGCT
GCCTTTTTGACACCGCGGTCGTCGATGGCGGATCTTATTGCTATGGGGGCACTGTTTGCGGCAAATGGCTGCTCGAATGGAAGCGTCGAGATTCCCTTCAGAGCTGGTAGAGTTGATGCC
ACTGGCCCGGGCCCGACAGGCGTGCCCAGACCCGAGCAGCCTTTGGATGAACACATTACCAGCTTCCAGAAGCAGGGATTCACTCCACAGGAAATGATCGGACTGGTTGCATGCGGTCAT
ACCCTTGGAGGAGTTCACGGTGTGGACTTTCCGGAGATTGTAGAC
GTTGTAAATGATCCGGTAAGATGCTCTTTTTGATCATGTCAACATGGCTATGGGACTGGGGGCCGCCTACTCAGA
ATTGAAGATGGGCTAACGGTTACGCGCAGGCCACAGATGACAACACTCAGACATTTGACACGACCAACTCAGGATTCACTGCCTTCGACAACACCGTGTAAGATATCAGCACTTGCTTGA
GAAAGAATACCAGCTAACATGAAGCAAGTGCTGTTCAATATGTGAACAACGTCACACAGAACCCCCTTGCCTTTGGCCACAATGAGACCACCAGATCTGATGCAAGAATCTTTGCTTCAG
ATGGAGGCATCGAAATTGGACGCATGGCAACTTCTCCTGCTTACTTTTACAAGACGTGCCAAGATCTGCTCGAGCGAATGATTAACACAGTCCCCAAGGGTGTGACTCTTACCGAGCCTC
TTCAGCCTTATCCTGTGAAGCCATCACGTCTATTTGCTACCGTCAACTCTAACGGAACGATGAGCTTGACTGGCTACATCCGA
GTTAGTTATTTTGTCTTTACAAATGATGAAACATAGA
ATAAGATTCACTAACGGAATTCACCATAGGTTATCGGTACTGTCGCCGCCAACCCCAACCGCTCCATCAAGCTTCACATCCACCCTCGTGCCGGAGTGACATGCACACCGGCTAAGCCTT
GCACTGTTAGCAACAACATCCCAGCATTCGCTTCCGGCCACGTCATGTACGGAAACCCCCCACTTACCTTCTGGACGTATCCCTTCACGGTTGAGGTGCCTCTTGCCCAGGGTATTTCCG
GATTTGACGTCGAGGTCATCGACAACATCAACGGAGTGACTAACAGCACTCTTCATACGAATGGCGGCAATGGATTCCCATTCGATGACACTCTTCTCACGCAACCGCAGCTCTCGTGCA
CCGAGACACACACTGAGGGACTAATGAACCTGACTGTTGCAGTAAGCTCACACACTTTAATCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTTGTCAAATCGTTTCCTCTCTGCCGTCGCCAAACTCGGCTTGGTAGCTGGCTCAGCTTATGCCGAGAAGGAACAAATCTGGCCAGCCAACACCGATCTCCTGGAGAGCATGCTC
TTTGAGCAACAAGGCTTCAACTCCCAAAACTCTCCTGCGACTTTTATTGTTCCTTGCGAAAAGGTTACCTTTGGCACCGGCCGTAACGGCGCCGCAGAATGGCTGCGTACAGCATATCAC
GACATGGCAACTGCGGATGTTGAGAATGGAATAGGAGGTATCGACGCGTCGATTGGATTTGAAGTCAACCGTGACGAGAACCCAGGTATTGGATTCAACGAGACGCTGATGAACCTGGCT
GCCTTTTTGACACCGCGGTCGTCGATGGCGGATCTTATTGCTATGGGGGCACTGTTTGCGGCAAATGGCTGCTCGAATGGAAGCGTCGAGATTCCCTTCAGAGCTGGTAGAGTTGATGCC
ACTGGCCCGGGCCCGACAGGCGTGCCCAGACCCGAGCAGCCTTTGGATGAACACATTACCAGCTTCCAGAAGCAGGGATTCACTCCACAGGAAATGATCGGACTGGTTGCATGCGGTCAT
ACCCTTGGAGGAGTTCACGGTGTGGACTTTCCGGAGATTGTAGAC
GCCACAGATGACAACACTCAGACATTTGACACGACCAACTCAGGATTCACTGCCTTCGACAACACCGTTGCTGTT
CAATATGTGAACAACGTCACACAGAACCCCCTTGCCTTTGGCCACAATGAGACCACCAGATCTGATGCAAGAATCTTTGCTTCAGATGGAGGCATCGAAATTGGACGCATGGCAACTTCT
CCTGCTTACTTTTACAAGACGTGCCAAGATCTGCTCGAGCGAATGATTAACACAGTCCCCAAGGGTGTGACTCTTACCGAGCCTCTTCAGCCTTATCCTGTGAAGCCATCACGTCTATTT
GCTACCGTCAACTCTAACGGAACGATGAGCTTGACTGGCTACATCCGA
GTTATCGGTACTGTCGCCGCCAACCCCAACCGCTCCATCAAGCTTCACATCCACCCTCGTGCCGGAGTGACA
TGCACACCGGCTAAGCCTTGCACTGTTAGCAACAACATCCCAGCATTCGCTTCCGGCCACGTCATGTACGGAAACCCCCCACTTACCTTCTGGACGTATCCCTTCACGGTTGAGGTGCCT
CTTGCCCAGGGTATTTCCGGATTTGACGTCGAGGTCATCGACAACATCAACGGAGTGACTAACAGCACTCTTCATACGAATGGCGGCAATGGATTCCCATTCGATGACACTCTTCTCACG
CAACCGCAGCTCTCGTGCACCGAGACACACACTGAGGGACTAATGAACCTGACTGTTGCAGTAAGCTCACACACTTTAATCTGA

Retrieve as FASTA