Entry information : LuAPx-R (Lus10002916|PACid:23148599)
Entry ID 12008
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-10 (Christophe Dunand)
Peroxidase information: LuAPx-R (Lus10002916|PACid:23148599)
Name (synonym) LuAPx-R (Lus10002916|PACid:23148599)
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuAPx-R
start..stop
S start..stop
RcAPx-R 371 6e-130 36..303 44..327
PtAPx-R 370 2e-129 20..303 30..336
VvAPx-R 365 3e-127 12..303 9..329
MeAPx-R 364 7e-127 41..303 57..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 77014..77146 133 N° 2 76828..76933 106 N° 3 76503..76630 128 N° 4 76323..76397 75
N° 5 75970..76066 97 N° 6 75821..75904 84 N° 7 75548..75736 189 N° 8 75355..75457 103
complement(join(75355..75457,75548..75736,75821..75904,75970..76066,76323..76397 ,76503..76630,76828..76933,77014..77146))


exon

Literature and cross-references LuAPx-R (Lus10002916|PACid:23148599)
DNA ref. Phytozome 12:   scaffold3059 (77146..75355)
Protein sequence: LuAPx-R (Lus10002916|PACid:23148599)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   305
PWM (Da):   %s   32874.57  
PI (pH):   %s   5.48
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPLAISRLKLSLFHSNSFFSSSPTLKFPSAVDVRCKSVRDSDAGEDCDWVSGGRRRMLVSISTLPFLTGLQFNASATDELGLDASGLIREEARKVVTKGRAAGVLRLAFHDAGTFDISEKSGGMNGSIIYELGRPENTGLNKSVKAISWADMIALSGAEAVSICGGPSIPLRIGRLDSMEADAEGRLPEETLDAPGLKQSFRSKGLSTQELVALSGAHTLGSKGFGNPIVFDNSYYKILLEKPWMSSVGMTNMVGLPSDRALVEDDECLRWIEVYAGDEEMFFQDFKTAYTKLVNSGAMWKSA*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCTTTAGCAATATCCCGCCTCAAGCTTTCTCTATTCCACTCCAATTCCTTCTTCTCTTCATCTCCAACACTCAAATTTCCCTCCGCCGTCGATGTCCGCTGCAAATCCGTCCGA
GACAGTGATGCTG
GTACTCACAAGTTTTCCCCGCTTTTTAGCTGTGTTCATCACTGGGTTTTGTTCACAATTTGTCAACTTTAACTGCTGCAGGGGAGGATTGTGATTGGGTTTCAGGTG
GACGCAGGAGAATGCTCGTCTCCATTTCCACGCTTCCGTTTCTAACTGGTTTGCAATTCAATGCCAGTGCCACTGACGA
GTGAGTTTCTGTATTCAAGATGTAGACTTTCTATGAACTGG
GGAACCAACCATGCTTAGGTTTGAGATAGGTGATAACTGAGTATTGGATTGTATGTATCTCACAAGCTTGTGAGCTTAATTGTTGCATGGTAGTGTCTGCCAATTGCCATGACAAATAAT
CCATGAGTTCAATCTTTGCTGCTATTGGTGAAAAAGGTTAGGCTTGGATGCTAGTGGGCTGATAAGGGAAGAGGCAAGGAAAGTAGTGACAAAGGGCAGGGCTGCTGGCGTGCTTCGTCT
TGCCTTTCATGATGCAGGAACCTTTGACATCAGTGAGAAATCAG
GTAATGTCTAGTTGTTAACAGTGAAATGGTTTGATTGATGCTCCTGAAGGACAGGGATTTGGTGAACTCTACGCTG
TTCTTAGTTTCGGATTTCTGTTACTGTAGGCGGTATGAACGGTTCGATAATCTACGAGCTCGGAAGGCCTGAAAATACTGGTTTAAACAAGTCAGTGAAGGCAAGTTCTCTCACTATCCA
ACTCTTCAAAGGATAGCATGCTTAGATGGAATGTATGTACTTGTACTCATTCAACGCAGCAAGGCTAATTCCCGAGCCGGTGTGTTCTGGTTTTTAGGTTCTCGAAAAGGCAAAGAGCGT
AGTGGACTCGAGACTGCCAGGTTCATATTCAAATGTCCAAGTGAAAACAACAAAAAGGAACGAATATTTTTTCCATAATTGAAGACATGGCCCCTAATGTGTGAGCTTTTTATCTGTCAG

TATCCTGGGCAGACATGATTGCTCTTTCTGGAGCTGAAGCAGTTTCCATCTGTGGTGGTCCTTCAATCCCCCTTCGAATCGGCAGACTGGATTCAAT
GTACGTAATGGAGTTCATACTCT
TGCTTGTTTTTTTTCTTCCCGATCCATTGTTCTTCAATGCAGGGAAGCTGATGCAGAAGGCAGACTTCCTGAAGAAACATTGGATGCTCCTGGTTTGAAGCAATCCTTCCGAAGCAAAGG
CCTATC
GTGAGTCGAAAAAGCAAAAAACCGTCCAATCCATATCTGCTCGAAACGAGCTGGGACATTTACATCCTCGATTTCCTTTTATAGGACGCAAGAACTTGTTGCATTGTCTGGAGC
TCATACTCTTGGCAGTAAAGGATTTGGGAACCCAATCGTCTTCGACAATTCTTACTACAAAATCCTTCTTGAGAAGCCATGGATGTCCTCGGTTGGCATGACGAACATGGTGGGGCTTCC
TTCGGACCGTGCACTTGTCGAAGACGATGAATGTCTAAG
GTTTTGATCATGGAATGACCAGCCAGTATAAAAAAACCATTATATTAATGATTTCTTTTTCTAATTTGGATTGGATAATCT
TGTTAACAGATGGATAGAAGTGTATGCGGGTGATGAGGAGATGTTCTTCCAAGATTTCAAGACTGCATATACCAAACTTGTGAACTCTGGCGCAATGTGGAAAAGCGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCTTTAGCAATATCCCGCCTCAAGCTTTCTCTATTCCACTCCAATTCCTTCTTCTCTTCATCTCCAACACTCAAATTTCCCTCCGCCGTCGATGTCCGCTGCAAATCCGTCCGA
GACAGTGATGCTG
GGGAGGATTGTGATTGGGTTTCAGGTGGACGCAGGAGAATGCTCGTCTCCATTTCCACGCTTCCGTTTCTAACTGGTTTGCAATTCAATGCCAGTGCCACTGACGAG
TTAGGCTTGGATGCTAGTGGGCTGATAAGGGAAGAGGCAAGGAAAGTAGTGACAAAGGGCAGGGCTGCTGGCGTGCTTCGTCTTGCCTTTCATGATGCAGGAACCTTTGACATCAGTGAG
AAATCAG
GCGGTATGAACGGTTCGATAATCTACGAGCTCGGAAGGCCTGAAAATACTGGTTTAAACAAGTCAGTGAAGGCAATATCCTGGGCAGACATGATTGCTCTTTCTGGAGCTGAA
GCAGTTTCCATCTGTGGTGGTCCTTCAATCCCCCTTCGAATCGGCAGACTGGATTCAAT
GGAAGCTGATGCAGAAGGCAGACTTCCTGAAGAAACATTGGATGCTCCTGGTTTGAAGCAA
TCCTTCCGAAGCAAAGGCCTATC
GACGCAAGAACTTGTTGCATTGTCTGGAGCTCATACTCTTGGCAGTAAAGGATTTGGGAACCCAATCGTCTTCGACAATTCTTACTACAAAATCCTT
CTTGAGAAGCCATGGATGTCCTCGGTTGGCATGACGAACATGGTGGGGCTTCCTTCGGACCGTGCACTTGTCGAAGACGATGAATGTCTAAG
ATGGATAGAAGTGTATGCGGGTGATGAG
GAGATGTTCTTCCAAGATTTCAAGACTGCATATACCAAACTTGTGAACTCTGGCGCAATGTGGAAAAGCGCTTAG

Retrieve as FASTA