Entry information : ClunCIIAA01
Entry ID 12019
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: ClunCIIAA01
Name ClunCIIAA01
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus lunatus (Curvularia lunata)    [TaxId: 5503 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ClunCIIAA01
start..stop
S start..stop
COsaCIIAA05 759 0 1..400 1..400
CheCIIAA05_C5 756 0 1..400 1..400
CheCIIAA05_C4 756 0 1..400 1..400
SturCIIAA02 743 0 1..403 1..403
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1058425..1059414 990 N° 2 1059467..1059691 225  
join(1058425..1059414,1059467..1059691)


exon

Literature and cross-references ClunCIIAA01
DNA ref. JGI genome:   scaffold_13 (1058425..1059691)
Cluster/Prediction ref. JGI gene:   53230
Protein sequence: ClunCIIAA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   405 (384)
PWM (Da):   %s   44274.07 (42028.9)  
PI (pH):   %s   7.43 (7.09) Peptide Signal:   %s   cut: 21 range:21-404
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTLSYISYALLACVSLTEAHPGMGNTMEEMRFLAAQQKRQSSKELIGDLKTLSDSKLTSIGKDIKSILLYEKNAESTTIDTSIPVGNIGSAACKADLCCHWKWLAYEMTAKFNGTSGRCSKFARQAVRLGFHDAGVWSKSSGYGGADGSILLSDEMSRTDNNGLAAIAEQTKKWYNKYNQYGMSMADIIQFGANVATVVCPLGPRLRTFVGRKDNSKAGPTGLLPAETDSADKLIKLFQDKTIDAHDLVALVGAHTTSQQHFVDTNRNGDPQDSTPGIWDMAFYPQTTNNPPPRVFKFQSDINLSKDSRTSASWAAFSDRATAQGRWNADYSKAYTRLSLLGVNNINDLKECTAVLPAERKTFVSEDQVVLDRWLQGEFDQLNDLVDNAIQLTGVISGRGEKS*

Retrieve as FASTA  
Remarks complete sequence from genomics (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTCTCTCCTACATCAGCTATGCCCTTCTGGCGTGCGTCTCCCTGACGGAAGCTCATCCAGGCATGGGCAACACGATGGAGGAAATGCGCTTCCTGGCTGCTCAACAGAAGCGT
CAATCTTCCAAAGAACTCATCGGCGACCTCAAGACCCTCTCAGACTCGAAGCTTACAAGTATTGGCAAGGACATCAAATCCATTCTCTTGTATGAAAAGAATGCTGAGTCTACTACTATC
GACACCTCGATCCCCGTTGGCAATATTGGCAGTGCAGCTTGCAAAGCTGACTTGTGTTGCCACTGGAAGTGGCTCGCGTATGAGATGACAGCCAAGTTCAACGGTACCTCTGGCCGTTGC
AGTAAGTTTGCTCGTCAAGCCGTTCGCTTAGGCTTCCACGACGCAGGTGTCTGGTCTAAGAGCAGTGGCTATGGTGGCGCAGACGGCAGCATTCTTCTTAGCGATGAGATGTCCCGAACA
GACAACAATGGCCTAGCAGCCATTGCCGAACAGACAAAGAAGTGGTACAATAAATACAACCAGTATGGAATGAGTATGGCCGATATCATCCAGTTCGGTGCCAATGTGGCGACTGTCGTT
TGTCCGTTGGGTCCTCGTCTCCGCACATTCGTCGGCCGCAAAGACAACAGCAAAGCGGGACCTACAGGCCTCCTTCCTGCGGAGACAGACTCGGCAGACAAACTCATCAAGCTTTTCCAA
GACAAAACCATTGACGCGCACGACCTCGTCGCTCTCGTGGGCGCTCACACAACGTCGCAGCAGCACTTTGTTGACACGAACCGCAACGGTGACCCGCAAGACTCAACACCCGGTATATGG
GATATGGCGTTCTATCCTCAGACGACGAACAACCCACCTCCCCGCGTCTTCAAGTTCCAAAGCGACATCAACCTGAGTAAGGACTCGAGAACAAGTGCATCCTGGGCGGCGTTCAGTGAC
AGGGCCACTGCACAGGGAAGATGGAATGCG
GTATGTATATGCCTCCACTAAATCCGAGCCCTAGAGCTAACATAGTGCAAAGGATTATTCCAAAGCCTACACGCGTTTGTCGTTGCTCGG
CGTCAATAACATCAACGACCTCAAGGAATGCACAGCCGTCCTACCAGCCGAGCGCAAGACGTTTGTCAGCGAGGATCAGGTTGTGCTAGATAGGTGGCTGCAAGGAGAATTCGATCAGCT
CAATGATTTGGTCGACAATGCTATTCAGCTCACGGGTGTTATATCGGGTAGAGGTGAGAAATCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTCTCTCCTACATCAGCTATGCCCTTCTGGCGTGCGTCTCCCTGACGGAAGCTCATCCAGGCATGGGCAACACGATGGAGGAAATGCGCTTCCTGGCTGCTCAACAGAAGCGT
CAATCTTCCAAAGAACTCATCGGCGACCTCAAGACCCTCTCAGACTCGAAGCTTACAAGTATTGGCAAGGACATCAAATCCATTCTCTTGTATGAAAAGAATGCTGAGTCTACTACTATC
GACACCTCGATCCCCGTTGGCAATATTGGCAGTGCAGCTTGCAAAGCTGACTTGTGTTGCCACTGGAAGTGGCTCGCGTATGAGATGACAGCCAAGTTCAACGGTACCTCTGGCCGTTGC
AGTAAGTTTGCTCGTCAAGCCGTTCGCTTAGGCTTCCACGACGCAGGTGTCTGGTCTAAGAGCAGTGGCTATGGTGGCGCAGACGGCAGCATTCTTCTTAGCGATGAGATGTCCCGAACA
GACAACAATGGCCTAGCAGCCATTGCCGAACAGACAAAGAAGTGGTACAATAAATACAACCAGTATGGAATGAGTATGGCCGATATCATCCAGTTCGGTGCCAATGTGGCGACTGTCGTT
TGTCCGTTGGGTCCTCGTCTCCGCACATTCGTCGGCCGCAAAGACAACAGCAAAGCGGGACCTACAGGCCTCCTTCCTGCGGAGACAGACTCGGCAGACAAACTCATCAAGCTTTTCCAA
GACAAAACCATTGACGCGCACGACCTCGTCGCTCTCGTGGGCGCTCACACAACGTCGCAGCAGCACTTTGTTGACACGAACCGCAACGGTGACCCGCAAGACTCAACACCCGGTATATGG
GATATGGCGTTCTATCCTCAGACGACGAACAACCCACCTCCCCGCGTCTTCAAGTTCCAAAGCGACATCAACCTGAGTAAGGACTCGAGAACAAGTGCATCCTGGGCGGCGTTCAGTGAC
AGGGCCACTGCACAGGGAAGATGGAATGCG
GATTATTCCAAAGCCTACACGCGTTTGTCGTTGCTCGGCGTCAATAACATCAACGACCTCAAGGAATGCACAGCCGTCCTACCAGCCGAG
CGCAAGACGTTTGTCAGCGAGGATCAGGTTGTGCTAGATAGGTGGCTGCAAGGAGAATTCGATCAGCTCAATGATTTGGTCGACAATGCTATTCAGCTCACGGGTGTTATATCGGGTAGA
GGTGAGAAATCCTAG

Retrieve as FASTA