Entry information : ClunCIIAC01
Entry ID 12020
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: ClunCIIAC01
Name ClunCIIAC01
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus lunatus (Curvularia lunata)    [TaxId: 5503 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ClunCIIAC01
start..stop
S start..stop
CheCIIAC04_C5 561 0 1..346 1..347
CheCIIAC04_C4 561 0 1..346 1..347
COsaCIIAC04 546 0 1..346 1..347
SturCIIAC01 494 3e-177 18..346 12..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1024828..1025062 235 N° 2 1025114..1025919 806  
join(1024828..1025062,1025114..1025919)


exon

Literature and cross-references ClunCIIAC01
DNA ref. JGI genome:   scaffold_6 (1024828..1025919)
Cluster/Prediction ref. JGI gene:   108402
Protein sequence: ClunCIIAC01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347 (326)
PWM (Da):   %s   37987.11 (35823.9)  
PI (pH):   %s   7.29 (7.00) Peptide Signal:   %s   cut: 21 range:21-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVHKAALAFPLLGLSLFVSAGPLQQREASPDWVDNEVGYGGVEKLYYEIIGGQKPPVDSHKEPKPEKCGKGSKDKCCVWFDVSTELTKLFLGEDKQCNDNARGAVRLGFHDAGSWDQSTTEGGADGSLLMDFGEQDRAENNGLQKVRTLLRGIQSKYKVGYADLVQYAHNHATVSCPKGPRVRTFIGRKDATKANTQGLLPNVHDNPDNLINLFGRKGISPRELAALLGAHATAHQRFTDTSPQAINKPLDTTPGIWDVEFYNDTLNNPSGSTADQKIFVLPSDKALSQHPRTSGDWHSFVGNQDGWNIDYARAYTKVSLFGVKQEQLARLVDCTKTLPASRDIFP*

Retrieve as FASTA  
Remarks complete sequence from genomics (1 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTCACAAGGCGGCACTAGCATTCCCCCTTCTGGGACTGTCCCTCTTCGTATCGGCAGGCCCCTTGCAACAGCGAGAGGCTTCTCCGGACTGGGTTGACAATGAGGTTGGCTATGGA
GGCGTCGAAAAGCTCTACTACGAGATCATTGGCGGTCAGAAGCCTCCTGTCGATAGCCACAAAGAACCAAAGCCTGAGAAATGTGGAAAGGGGAGCAAAGACAAGTGCTGCGTGT
GTAGG
TTGAATGAAGCTTACTCTTGTTCCCCTAGATATTGACGGATAATAGGGTTCGATGTTTCCACTGAACTCACAAAACTATTTTTAGGAGAGGACAAGCAATGCAATGACAACGCTCGAGGA
GCAGTCCGCCTGGGCTTTCACGATGCTGGATCTTGGGACCAAAGCACCACTGAGGGCGGTGCTGACGGATCACTGCTCATGGACTTTGGTGAGCAAGACCGCGCAGAGAACAATGGCCTA
CAGAAGGTTCGCACACTGCTACGTGGAATCCAGTCGAAGTACAAGGTGGGTTATGCTGACCTTGTACAATACGCTCACAACCACGCCACCGTCTCATGTCCAAAGGGACCTCGGGTGCGT
ACATTCATCGGCCGAAAGGATGCCACCAAGGCAAACACCCAAGGCCTTCTTCCTAACGTCCATGACAACCCCGACAACCTTATCAACCTCTTCGGAAGAAAGGGTATCTCTCCACGCGAA
CTCGCAGCTCTCCTCGGTGCTCATGCAACAGCGCATCAACGCTTCACCGACACATCTCCGCAGGCGATCAACAAGCCTCTCGACACTACTCCTGGCATCTGGGACGTGGAGTTCTACAAC
GATACACTCAACAACCCCAGCGGTTCGACAGCTGATCAGAAGATCTTTGTCCTTCCCAGCGACAAAGCGCTGTCCCAACATCCCCGGACTAGCGGTGACTGGCATAGCTTTGTAGGCAAC
CAGGATGGTTGGAACATCGATTATGCCAGGGCCTACACCAAGGTCAGCCTGTTTGGCGTCAAGCAGGAACAGTTGGCGAGGTTGGTGGACTGCACCAAGACGCTACCTGCTAGCCGCGAC
ATATTCCCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTCACAAGGCGGCACTAGCATTCCCCCTTCTGGGACTGTCCCTCTTCGTATCGGCAGGCCCCTTGCAACAGCGAGAGGCTTCTCCGGACTGGGTTGACAATGAGGTTGGCTATGGA
GGCGTCGAAAAGCTCTACTACGAGATCATTGGCGGTCAGAAGCCTCCTGTCGATAGCCACAAAGAACCAAAGCCTGAGAAATGTGGAAAGGGGAGCAAAGACAAGTGCTGCGTGT
GGTTC
GATGTTTCCACTGAACTCACAAAACTATTTTTAGGAGAGGACAAGCAATGCAATGACAACGCTCGAGGAGCAGTCCGCCTGGGCTTTCACGATGCTGGATCTTGGGACCAAAGCACCACT
GAGGGCGGTGCTGACGGATCACTGCTCATGGACTTTGGTGAGCAAGACCGCGCAGAGAACAATGGCCTACAGAAGGTTCGCACACTGCTACGTGGAATCCAGTCGAAGTACAAGGTGGGT
TATGCTGACCTTGTACAATACGCTCACAACCACGCCACCGTCTCATGTCCAAAGGGACCTCGGGTGCGTACATTCATCGGCCGAAAGGATGCCACCAAGGCAAACACCCAAGGCCTTCTT
CCTAACGTCCATGACAACCCCGACAACCTTATCAACCTCTTCGGAAGAAAGGGTATCTCTCCACGCGAACTCGCAGCTCTCCTCGGTGCTCATGCAACAGCGCATCAACGCTTCACCGAC
ACATCTCCGCAGGCGATCAACAAGCCTCTCGACACTACTCCTGGCATCTGGGACGTGGAGTTCTACAACGATACACTCAACAACCCCAGCGGTTCGACAGCTGATCAGAAGATCTTTGTC
CTTCCCAGCGACAAAGCGCTGTCCCAACATCCCCGGACTAGCGGTGACTGGCATAGCTTTGTAGGCAACCAGGATGGTTGGAACATCGATTATGCCAGGGCCTACACCAAGGTCAGCCTG
TTTGGCGTCAAGCAGGAACAGTTGGCGAGGTTGGTGGACTGCACCAAGACGCTACCTGCTAGCCGCGACATATTCCCATAG

Retrieve as FASTA