Entry information : ClunCIIAB01
Entry ID 12022
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: ClunCIIAB01
Name ClunCIIAB01
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus lunatus (Curvularia lunata)    [TaxId: 5503 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ClunCIIAB01
start..stop
S start..stop
CheCIIAB03_C5 349 1e-121 1..295 1..294
CheCIIAB03_C4 349 1e-121 1..295 1..294
ClunCIIAB02 343 2e-119 4..293 6..293
COsaCIIAB03 342 4e-119 1..295 1..294
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 838181..838858 678 N° 2 838927..839136 210  
join(838181..838858,838927..839136)


exon

Literature and cross-references ClunCIIAB01
DNA ref. JGI genome:   scaffold_4 (838181..839136)
Cluster/Prediction ref. JGI gene:   105041
Protein sequence: ClunCIIAB01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   296 (276)
PWM (Da):   %s   31929.92 (29891.9)  
PI (pH):   %s   6.88 (6.51) Peptide Signal:   %s   cut: 20 range:20-295
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRPSTAFFALAATPISAFSLNFWRRTGSCPAVWTQIAEELKATMAGCGRDAHGAIRAVFHDCITDGCNGSLILSDECTTRTENRGLSFTCDKLNGLREKYGVGAADIIQFAGAIAISACPLGPRVQALVGRKDSSEPAAQGGVPGSRDSVERILEVFSAKGFSPDDLVALLGTHSVALQFFDDTTQAGKSLDYTPGKMDIRFYGDTLHQTAPYSLQSDRLLSNASETRRTWAVYSKSTASWSEAFAPAWNRFAVIGSNSEDLQDCSALIPQSSVRRERLEANEAFVDKLRKKFIA*

Retrieve as FASTA  
Remarks complete sequence from genomics (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCCCTCAACCGCCTTCTTTGCCCTCGCGGCAACCCCCATCTCCGCTTTCAGTCTCAATTTCTGGCGCCGTACCGGCTCCTGCCCAGCTGTCTGGACTCAGATAGCTGAAGAACTC
AAGGCTACAATGGCCGGTTGCGGCAGAGACGCCCATGGAGCCATTCGCGCTGTATTTCACGATTGTATCACCGATGGCTGCAATGGCAGTTTGATCCTCAGCGATGAATGCACCACGCGA
ACTGAAAACAGAGGGCTCTCCTTTACCTGCGACAAGCTCAATGGCTTGCGAGAGAAGTACGGTGTTGGTGCTGCAGACATAATTCAATTTGCTGGTGCCATTGCAATTTCCGCATGTCCG
CTCGGCCCCCGCGTCCAAGCATTGGTGGGAAGAAAAGATAGCAGCGAACCCGCTGCTCAAGGCGGTGTCCCCGGTAGCCGCGACTCGGTAGAAAGGATTCTAGAGGTATTCAGTGCTAAG
GGTTTCTCACCAGACGACTTAGTCGCGTTACTGGGAACGCATAGTGTGGCACTGCAGTTCTTTGACGATACTACTCAGGCTGGAAAGTCGCTTGACTACACGCCGGGGAAGATGGATATC
AGGTTCTATGGCGACACATTGCATCAAACTGCCCCATACAGTTTGCAAAGTGATCGTCTCCTATCCAATGCGAGCGAG
GTGCGTATCCCATACAACGCATCACTCTAATCAGATAAGCAT
TACAGCTAACAATTGATAAATGCCAGACTCGGAGAACATGGGCCGTTTACAGCAAATCAACTGCTAGCTGGAGCGAGGCATTTGCTCCAGCATGGAACCGGTTTGCAGTCATTGGTTCCA
ATTCAGAGGACCTTCAAGATTGCTCGGCTCTTATTCCACAGTCCAGTGTTCGCCGCGAAAGGCTCGAAGCTAATGAAGCTTTCGTGGACAAGTTGCGTAAGAAGTTTATTGCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCCCTCAACCGCCTTCTTTGCCCTCGCGGCAACCCCCATCTCCGCTTTCAGTCTCAATTTCTGGCGCCGTACCGGCTCCTGCCCAGCTGTCTGGACTCAGATAGCTGAAGAACTC
AAGGCTACAATGGCCGGTTGCGGCAGAGACGCCCATGGAGCCATTCGCGCTGTATTTCACGATTGTATCACCGATGGCTGCAATGGCAGTTTGATCCTCAGCGATGAATGCACCACGCGA
ACTGAAAACAGAGGGCTCTCCTTTACCTGCGACAAGCTCAATGGCTTGCGAGAGAAGTACGGTGTTGGTGCTGCAGACATAATTCAATTTGCTGGTGCCATTGCAATTTCCGCATGTCCG
CTCGGCCCCCGCGTCCAAGCATTGGTGGGAAGAAAAGATAGCAGCGAACCCGCTGCTCAAGGCGGTGTCCCCGGTAGCCGCGACTCGGTAGAAAGGATTCTAGAGGTATTCAGTGCTAAG
GGTTTCTCACCAGACGACTTAGTCGCGTTACTGGGAACGCATAGTGTGGCACTGCAGTTCTTTGACGATACTACTCAGGCTGGAAAGTCGCTTGACTACACGCCGGGGAAGATGGATATC
AGGTTCTATGGCGACACATTGCATCAAACTGCCCCATACAGTTTGCAAAGTGATCGTCTCCTATCCAATGCGAGCGAG
ACTCGGAGAACATGGGCCGTTTACAGCAAATCAACTGCTAGC
TGGAGCGAGGCATTTGCTCCAGCATGGAACCGGTTTGCAGTCATTGGTTCCAATTCAGAGGACCTTCAAGATTGCTCGGCTCTTATTCCACAGTCCAGTGTTCGCCGCGAAAGGCTCGAA
GCTAATGAAGCTTTCGTGGACAAGTTGCGTAAGAAGTTTATTGCCTAG

Retrieve as FASTA