Entry information : ClunCIIAB02
Entry ID 12023
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: ClunCIIAB02
Name ClunCIIAB02
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus lunatus (Curvularia lunata)    [TaxId: 5503 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ClunCIIAB02
start..stop
S start..stop
AalteCIIAB01 439 3e-157 5..295 4..294
AbraCIIAB03 413 6e-147 5..294 4..293
Ssrc1lsm3aCIIAB06 405 7e-144 6..278 5..276
PtritCIIAB04 387 1e-136 8..295 7..293
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 518943..519620 678 N° 2 518612..518821 210  
complement(join(518612..518821,518943..519620))


exon

Literature and cross-references ClunCIIAB02
DNA ref. JGI genome:   scaffold_2 (519620..518612)
Cluster/Prediction ref. JGI gene:   101558
Protein sequence: ClunCIIAB02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   296 (275)
PWM (Da):   %s   31127.18 (29019.1)  
PI (pH):   %s   6.5 (5.75) Peptide Signal:   %s   cut: 21 range:21-295
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHYPISITLLALAATSPASAISLWPRADGCPSVWKDVASELQSAFAGCGADAHGAIRAPFHDCINNGCDGSLILSDECSRRENSGLTNICGKLKGWSDKYKVGAADMIQFAAATAISACPLGPKVQALVGRKDSQTASNVGSVPSSRDSVSNILSAFSAKGFSADDVVALLGTHTVAIQFFDDPAQAGKPLDSTPGTYDTNFYKETRDGKAPYSLQSDLLMANATETGATWSSFADSADKWMAAFTSAWNRFAVVGNDVGQLQDCSSLIGSSSVSRKRMEANARFTERMSAKFRV*

Retrieve as FASTA  
Remarks complete sequence from genomics (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTATCCTATCTCTATCACACTCCTCGCCCTCGCGGCCACATCGCCTGCTTCAGCTATCAGCCTCTGGCCTCGCGCTGACGGTTGCCCGTCGGTATGGAAGGATGTAGCTTCGGAA
TTGCAATCAGCATTCGCAGGTTGTGGCGCAGATGCTCATGGCGCCATCCGCGCACCCTTCCATGACTGTATCAACAACGGCTGTGACGGTAGCCTCATCCTCTCAGACGAATGCTCGCGC
CGCGAAAACTCAGGCCTCACCAACATATGCGGGAAGCTCAAGGGCTGGTCCGACAAGTACAAAGTTGGCGCTGCAGACATGATCCAATTTGCCGCCGCAACCGCAATCTCTGCCTGTCCG
CTGGGACCCAAAGTGCAAGCTCTCGTCGGCCGGAAAGACAGCCAAACCGCATCAAATGTCGGAAGCGTGCCGTCGAGTCGCGACTCAGTCAGCAATATCTTGTCAGCTTTTTCGGCAAAA
GGATTTTCAGCAGATGATGTTGTGGCGCTTCTAGGCACACATACTGTCGCCATCCAGTTCTTCGATGATCCAGCGCAGGCAGGCAAGCCTCTGGATTCGACGCCAGGAACGTACGACACC
AATTTCTACAAGGAGACCAGGGACGGCAAGGCGCCGTATAGTCTGCAGAGCGACCTTTTGATGGCAAATGCGACAGAG
GTATGTTACTTCCCGTTTCCCCCATGCCACGTCCTGCACAAC
TGATCTATTTTCCCTCACCCTGCTTTGACACTGTCTCATACTTTAAAAAGATGCACTTTGACTAATGGTCTCGATTTAGACTGGAGCTACATGGTCATCATTTGCCGACTCAGCAGATAA
ATGGATGGCTGCATTCACCAGTGCCTGGAATAGATTCGCGGTTGTCGGTAACGACGTAGGACAACTTCAGGACTGCTCTAGCCTTATCGGAAGCAGCAGTGTGAGCAGGAAAAGAATGGA
GGCTAATGCGAGATTTACCGAGAGAATGAGTGCAAAGTTTAGGGTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTATCCTATCTCTATCACACTCCTCGCCCTCGCGGCCACATCGCCTGCTTCAGCTATCAGCCTCTGGCCTCGCGCTGACGGTTGCCCGTCGGTATGGAAGGATGTAGCTTCGGAA
TTGCAATCAGCATTCGCAGGTTGTGGCGCAGATGCTCATGGCGCCATCCGCGCACCCTTCCATGACTGTATCAACAACGGCTGTGACGGTAGCCTCATCCTCTCAGACGAATGCTCGCGC
CGCGAAAACTCAGGCCTCACCAACATATGCGGGAAGCTCAAGGGCTGGTCCGACAAGTACAAAGTTGGCGCTGCAGACATGATCCAATTTGCCGCCGCAACCGCAATCTCTGCCTGTCCG
CTGGGACCCAAAGTGCAAGCTCTCGTCGGCCGGAAAGACAGCCAAACCGCATCAAATGTCGGAAGCGTGCCGTCGAGTCGCGACTCAGTCAGCAATATCTTGTCAGCTTTTTCGGCAAAA
GGATTTTCAGCAGATGATGTTGTGGCGCTTCTAGGCACACATACTGTCGCCATCCAGTTCTTCGATGATCCAGCGCAGGCAGGCAAGCCTCTGGATTCGACGCCAGGAACGTACGACACC
AATTTCTACAAGGAGACCAGGGACGGCAAGGCGCCGTATAGTCTGCAGAGCGACCTTTTGATGGCAAATGCGACAGAG
ACTGGAGCTACATGGTCATCATTTGCCGACTCAGCAGATAAA
TGGATGGCTGCATTCACCAGTGCCTGGAATAGATTCGCGGTTGTCGGTAACGACGTAGGACAACTTCAGGACTGCTCTAGCCTTATCGGAAGCAGCAGTGTGAGCAGGAAAAGAATGGAG
GCTAATGCGAGATTTACCGAGAGAATGAGTGCAAAGTTTAGGGTATAG

Retrieve as FASTA